Nanodrop 2000c

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, China, United Kingdom, Switzerland, France, Italy, Japan, Denmark, Australia, Canada, Austria, Spain, Cameroon, Finland, Sweden, Morocco, Singapore, India, Lithuania, Egypt, Netherlands

The NanoDrop 2000c is a compact spectrophotometer designed for the measurement of nucleic acid and protein concentrations. It utilizes a patented sample retention technology that requires only 1-2 microliters of sample to perform measurements. The NanoDrop 2000c provides accurate and reproducible results with a wide linear detection range.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

NanoDrop 2000c device Nanodrop 2000c Spectrophotemeter NanoDrop ND-2000c spectrophotometer Spectro-photometer (NanoDrop 2000c, Nanodrop 2000/2000C spectrophotometry NanoDrop 2000c ultraviolet spectrophotometer NanoDrop 2000/2000c Spectrophotometer NanoDrop 2000c spectrophotometry NanoDrop 2000/2000c instrument NanoDrop 2000c spectrometer

1 824 protocols using nanodrop 2000c

Isolation and Quantification of Total RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the extracted PBMCs using Wizol reagent
M (Wizbiosolutions, Seongnam, South Korea). After RNA extraction,
spectrophotometry (NanoDrop 2000c; Thermo Scientific) was used for
the RNA quantification. RNA samples having ratio of absorbance at
260 and 280 nm (A260/A280) of 1.8–2.2 nm were used for cDNA
synthesis. cDNA synthesis was carried out using M-MLV reverse transcriptase
(Invitrogen). The transcribed cDNA was quantified by spectrophotometry
(NanoDrop 2000c; Thermo Scientific). After quantification, each sample
was diluted to make final concentration up to 500 ng/μL.

Chudhary H.R., Ali A., Bibi S., Waqas M., Rafique S., Idrees M., Halim S.A., Abdellattif M.H., Khan A, & Al-Harrasi A. (2023). Transcriptional Analysis of TP53 Gene in Chronic Hepatitis C Patients Treated with Sofosbuvir, Daclatasvir, Pegylated Interferon, and Ribavirin. ACS Omega, 8(16), 14784-14791.

+ Open protocol

+ Expand

Skin and PBMC Lysate Immunization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Preparation of skin lysate: The back of the C57BL/6 mouse was shaved with an animal hair trimmer and depilated with cream. The mouse was killed by cervical dislocation. The depilated skin was treated with 70% ethanol, excised, and transferred to a conditionally sterile laminar. Subcutaneous fatty tissue was removed from the skin. The skin was cut into 3 × 3 mm fragments. The fragments were placed in a mortar, wet with liquid nitrogen, and rubbed with a pestle. The procedure was repeated until a homogeneous mass was formed. Five milliliters of PBS were added to the obtained homogeneous mass. Then, the obtained mass was passed through a 220 nm filter, and the protein concentration in the resulting solution was measured with a NanoDrop 2000c (Thermo Fisher Scientific, Waltham, MA, USA).
Preparation of human PBMC lysate: Human PBMC was prepared by centrifugation of fresh venous blood on a Ficoll-Urografin density gradient (1.077 g/cm³). PBMC was collected, washed two times in PBS, and then frozen and thawed three times. The obtained suspension was passed through a 220 nm filter, and the protein concentration in the solution was measured with a NanoDrop 2000c (Thermo Fisher Scientific).
The mice were immunized on day 0, day 7, and day 21. A 50 µg (by protein) quantity of the lysate was mixed with an equal volume of incomplete Freund’s adjuvant and injected into the base of the tail.

Tereshchenko V., Shevyrev D., Fisher M., Bulygin A., Khantakova J, & Sennikov S. (2023). TCR Sequencing in Mouse Models of Allorecognition Unveils the Features of Directly and Indirectly Activated Clonotypes. International Journal of Molecular Sciences, 24(15), 12075.

+ Open protocol

+ Expand

Comprehensive RNA and DNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from fresh frozen samples of renal cortex, tumor and adjacent non-tumor tissues and purified by standard phenol-chloroform extraction techniques. The quantity and purity of DNA were measured by NanoDrop 2000c (Thermo Scientific, Wilmington, DE, USA).
Total RNA was isolated from fresh samples of tumor and adjacent normal tissue using miRNeasy kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions and stored in RNAlater. All samples were treated with DNAse (Qiagen, Valencia, CA, USA). RNA samples were stored at −80°C. The quantity and purity of RNA was measured using NanoDrop 2000c (Thermo Scientific, Wilmington, DE, USA). Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to determine the RNA integrity number which ranged between 8–10.

Karanović S., Ardin M., Tang Z., Tomić K., Villar S., Renard C., Venturini E., Lorch A.H., Lee D.S., Stipančić Ž., Slade N., Vuković Brinar I., Dittrich D., Karlović K., Borovečki F., Dickman K.G., Olivier M., Grollman A.P., Jelaković B, & Zavadil J. (2021). Molecular profiles and urinary biomarkers of upper tract urothelial carcinomas associated with aristolochic acid exposure. International Journal of Cancer, 150(2), 374-386.

+ Open protocol

+ Expand

Fluorescein Release Kinetics of Polymeric Micelles

Check if the same lab product or an alternative is used in the 5 most similar protocols

The concentration of sodium fluorescein was calculated by measuring the UV absorbance (Nanodrop 2000c, Thermo Fisher Scientific, Basingstoke, UK) compared to stock solutions. To determine the kinetics of sodium fluorescein release, PM samples were kept at room temperature (20 °C) under constant dialysis (regenerated cellulose, 10,000 MWCO, Sigma-Aldrich, Poole, UK) against PBS. At various intervals over a total of 7 days PM samples were collected. 1 mL aliquots of each sample was then passed through a size separation column, before measurement of UV absorbance (Nanodrop 2000c, Thermo Fisher Scientific, Basingstoke, UK). Each experiment was performed in triplicate. All of the preparations give a 3 mg/mL solution of PMs. For all in vitro experiments PM samples were used immediately and were sterile filtered through a 0.2 μm cellulose acetate syringe filter before use.

Scarpa E., Bailey J.L., Janeczek A.A., Stumpf P.S., Johnston A.H., Oreffo R.O., Woo Y.L., Cheong Y.C., Evans N.D, & Newman T.A. (2016). Quantification of intracellular payload release from polymersome nanoparticles. Scientific Reports, 6, 29460.

+ Open protocol

+ Expand

Osteogenic Differentiation Marker Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expressions of RUNX2 family transcription factor (RUNX2), osteopontin (OPN), and osteocalcin (OCN) were evaluated by qRT-PCR assay. MC3T3-E1 cells were cultured in a 6-well plate at a density of 1 × 10⁵ per well and cultured as before for 14 days. The total RNA was extracted following the manufacturer’s instructions (ZHONGSHI TONTRU, Tianjin, China), and the concentration was calculated by NanoDrop 2000C (Thermal Fisher Scientific, United States). RNA was reversely transcribed to cDNA by the Reverse Transcription Kit (ZHONGSHI TONTRU, Tianjin, China). Then, an ABI Prism 7,500 Real-Time PCR system (Applied Biosystem, United States) was used after the Mix was added according to the instructions of the Fluorescence Quantitative PCR Kit (ZHONGSHI TONTRU, Tianjin, China). GAPDH was a normalized gene, and the control group was set as 1. The relative expression levels of RUNX2, OCN, and OPN were evaluated (n = 3) by the 2^-△△CT method. Thermo Fisher synthesized the primers, and the sequence is shown in Table 1.

Li S., Xiaowen Y., Yang Y., Liu L., Sun Y., Liu Y., Yin L, & Chen Z. (2023). Osteogenic and anti-inflammatory effect of the multifunctional bionic hydrogel scaffold loaded with aspirin and nano-hydroxyapatite. Frontiers in Bioengineering and Biotechnology, 11, 1105248.

+ Open protocol

+ Expand

FITC-dextran Release from Hydrogels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fn and aFn were soaked into a FITC-dextran solution (20 μg/mL) for 48 h to allow uniform loading. The FITC-dextran loaded hydrogels were incubated with PBS supplemented with 1% BSA under 37 °C. After 24 h, the fluorescence of the solution was measured with a nanodrop (2000C, Thermal Fisher Scientific, Waltham, MA) and the amount of released dextran was quantified by comparing with a standard FITC-dextran solution.

Zhao N., Coyne J., Abune L., Shi P., Lian X.L., Zhang G, & Wang Y. (2020). Exogenous Signaling Molecules Released from Aptamer-Functionalized Hydrogels Promote the Survival of Mesenchymal Stem Cell Spheroids. ACS applied materials & interfaces, 12(22), 24599-24610.

+ Open protocol

+ Expand

Soil DNA and RNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The samples were soaked in 75% ethanol for 30 s and then rinsed 3 times with ddH₂O. DNA was extracted using the Fast DNA Spin Kit for SOIL (MP Biomedicals, Santa Ana, CA, USA). The concentration and purity of extracted DNA were detected by NanoDrop 2000C (Thermo Fisher Scientific, USA), and the DNA quality was measured with 1.5% agarose gel electrophoresis. Total RNA was isolated from samples using the TRIZOL total RNA isolation system (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. RNA quality was measured on 1.5% agarose gels and quantified using a Nano-Drop 2000 (Thermo Scientific, Wilmington, DE, USA). cDNA was synthesized from 1 μg of total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China), according to the manufacturer’s instructions. cDNA was used for RT-qPCR assay and DNA was used to detect bacterial copy number.

Xue H., Zhao Y., Wang L., Zhu X., Zhang K., Li D., Ji J., Niu L., Cui J., Luo J, & Gao X. (2022). Regulation of amino acid metabolism in Aphis gossypii parasitized by Binodoxys communis. Frontiers in Nutrition, 9, 1006253.

+ Open protocol

+ Expand

Quantifying Pro-Inflammatory Cytokine Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from cartilage explants and synoviocytes as previously described [33 (link)]. Total RNA concentration was determined using a Nanodrop-2000c (Thermo Fisher Scientific). Complimentary DNA (cDNA) was prepared [33 (link)]. Real-time qPCR was used to measure relative gene expression for markers of three pro-inflammatory cytokines: Interleukin 1 beta (IL1β), Interleukin 6 (IL6) and Tumour Necrosis Factor alpha (TNFα) compared to the reference gene glyceraldehydes-3-phosphatedhyrogenase (GAPDH) as described previously using SYBR Green technology [33 (link)]. Primer sequences are listed in Table 2.Table 2

Primer sequences of the reference gene (GAPDH) and pro-inflammatory cytokines IL1β, IL6 and TNFα used in the study

Gene	GeneBank Accession	Direction	Primer Sequence (5′-3′)
GAPDH	NM_001163856	Forward	GCATCGTGGAGGGACTCA
GAPDH	NM_001163856	Reverse	GCCACATCTTCCCAGAGG
IL-1β	NM_001317261	Forward	GCCTAAGAATACTACATCCAGAGA
IL-1β	NM_001317261	Reverse	GGCATTGATTAGACAACAGTGAA
IL-6	NM_001082496	Forward	CTGCTCCTCGTGATGGCTAC
IL-6	NM_001082496	Reverse	CCGAGGATGTACTTAATGTGCTG
TNF-α	NM_001081819	Forward	CCTTCCACTCAATCAACCCTCT
TNF-α	NM_001081819	Reverse	CACGCCCACTCAGCCACT

Primer sequences of the reference gene (GAPDH) and proinflammatory cytokines IL1β, IL6 and TNFα used in the study

Rubio-Martínez L.M., Rioja E., Castro Martins M., Wipawee S., Clegg P, & Peffers M.J. (2017). Local anaesthetics or their combination with morphine and/or magnesium sulphate are toxic for equine chondrocytes and synoviocytes in vitro. BMC Veterinary Research, 13, 318.

+ Open protocol

+ Expand

Quantification of miR-133a Expression

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The detailed protocols for RNA extraction and miRNA assay are described in our previous publications (Mishra et al., 2009b (link); Chavali et al., 2014 (link); Nandi et al., 2016 (link)). In brief, we used mirVana miRNA Isolation Kit (cat # AM1560, Life Technologies, United States) to extract miRNA. After confirming good quality RNA by NanoDrop 2000c (Thermo Fisher Scientific, Waltham, MA, United States), we made complimentary DNA using TaqMan^® MicroRNA reverse transcription kit (cat # 4366597, Life Technologies, United States), and then amplified miRNA by qPCR using Taqman primers specific for miR-133a (Assay ID-002246, Life Technologies, United States) and U6 SnRNA (assay ID: 001973, Life Technologies, United States). U6 SnRNA was endogenous control for miR-133a assay (Figure 5). We used Bio-Rad CFX qPCR instrument and analyzed the results by Bio-Rad CFX Manager3.0 software (Bio-Rad Laboratories, United States).

Nandi S.S., Shahshahan H.R., Shang Q., Kutty S., Boska M, & Mishra P.K. (2018). MiR-133a Mimic Alleviates T1DM-Induced Systolic Dysfunction in Akita: An MRI-Based Study. Frontiers in Physiology, 9, 1275.

+ Open protocol

+ Expand

RNA Extraction from Embryonic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse embryonic fibroblasts and embryoid bodies using the Masterpure RNA Purification Kit (Epicentre) as described in Muniz et al (2017). The RNA was suspended to a concentration of 100 ng/μl using nuclease‐free water (Epicentre). The concentration of the RNA was measured using a spectrophotometer (NanoDrop 2000c; Thermo Fisher Scientific).

Deb S., Felix D.A., Koch P., Deb M.K., Szafranski K., Buder K., Sannai M., Groth M., Kirkpatrick J., Pietsch S., Gollowitzer A., Groß A., Riemenschneider P., Koeberle A., González‐Estévez C, & Rudolph K.L. (2020). Tnfaip2/exoc3‐driven lipid metabolism is essential for stem cell differentiation and organ homeostasis. EMBO Reports, 22(1), e49328.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!