Hiscribe t7 quick high yield rna synthesis kit

Ppp2r2a knockout mice were generated at the Australian Phenomics Network (Monash University, Melbourne, Australia), using the CRISPR/Cas9 technology. The CRISPR Design site http://crispr.mit.edu/ was used to identify guide RNA target sites flanking exon ENSMUSE00000482200 (exon 4) of the Ppp2r2a gene. The following guide RNAs were used: – 5′ TACGATAAAGCAGCCTAGTT 3′ for the 5′ end of exon 4, and – 5′ TTTGCTTTCAGGTACTACAT 3′ for the 3′ end of exon 4. Complementary oligonucleotides corresponding to the RNA guide target sites were annealed and cloned into BbsI (NEB) digested plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230). Single guide RNAs (sgRNA) were generated using the HiScribe^TM T7 Quick High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. The sgRNAs were purified using the RNeasy Mini Kit (Qiagen). Cas9 mRNA (30 ng/mL, Sigma) and the sgRNAs (15 ng/mL) were microinjected into the cytoplasm of C57BL/6J zygotes at the pronuclei stage. Injected zygotes were transferred into the uterus of pseudopregnant F1 (C57BL/6 × CBA) females. Forward (5′ GTGTTCCAGCCAGCTGTTTCT 3′) and reverse (5′ GACACTGCTGCCTATGTCTGCT 3′) genotyping PCR primers flanking the targeted region and amplifying a product of 819 bp from the wild-type DNA were used to characterize gene editing events in the resulting mice.

FRI gene, accession Bra035723 (Sun et al., 2013 (link)), was obtained from the Brassica database¹. It was aligned with other Brassica sequences deposited in the NCBI GenBank with CLC Genomics software (Qiagen) to design ‘FRI-Seq’ sequencing primers (Table 1). ‘PDS-Seq-Dig’ sequencing primers (Table 1) were designed by aligning B. napus PDS gene (HM989807) with other GenBank sequences. PCR products were cloned in a pGEM-T-Easy Vector System (Promega), and the plasmid DNA was Sanger-sequenced.
The sequences of FRI and PDS genes obtained from three Brassica species (B. oleracea, B. napus, and B. rapa) were aligned with CLC Genomics software, and potential target sites in conserved regions of FRI and PDS genes were designed with CLC Genomics Workbench and CRISPR RGEN Tools Cas-Designer (Park et al., 2015 (link)).
Double-stranded template DNA for in vitro transcription was obtained by annealing two overlapping oligonucleotides as described by Gagnon et al. (2014) (link). sgRNAs (Table 2) were transcribed in vitro with a HiScribe^TM T7 Quick High Yield RNA Synthesis Kit (NEB), purified with a MEGAclear^TM Kit (Ambion) according to the manufacturer’s instructions and quantified using a NanoVue Plus spectrophotometer (GE Healthcare).

Chicken δ-crystallin (CDC) mRNA was transcribed in vitro by a HiScribeTM T7 Quick High Yield RNA Synthesis Kit (purchased from NEB). The pre-mRNA was capped in the transcription reaction by incorporating m7GpppG (the ratio of m7GpppG to GTP was 4 : 1). Briefly, the in vitro transcription reaction was performed in 20 μL volumes at 37 °C for 1 h with 1 μg template DNA, 2 μL NTP buffer mix (5 mM of each NTP) and 2 μL T7 RNA polymerase mix. Then to remove the template DNA, 2 μL of DNase I (RNase-free, U mL^–1) was added and the mixture was incubated at 37 °C for 20 min. The transcribed pre-mRNA was purified by Trizol and redissolved in RNase-free water. The purified pre-mRNA was qualified by Nanodrop 2000 and then stored at –80 °C for future use.

sgRNA sequences were designed following the principle of 5′-GG-(N)18-NGG-3′ [44 (link)] using the online sgRNA design tool CHOPCHOP (https://chopchop.cbu.uib.no/; accessed on 3 March 2023), and CRISPR RGEN tools (https://www.rgenome.net/cas-offinder/; accessed on 3 March 2023) were used for mismatches. Finally, two sgRNA targets were successfully designed on exon 3 of the P. xylostella Piwi gene. Oligonucleotides containing the T7 promoter and sgRNA sequences were designed (Table S1). To generate an in vitro template for sgRNA transcription, PCR amplification was performed using the Super-Fidelity DNA Polymerase (Vazyme, China) and the designed oligonucleotides (Table S1). The resulting PCR products were visualized via agarose gel electrophoresis, purified using the Gel Extraction Kit (Omega, Norcross, GA, USA), and then utilized as the template for the in vitro transcription of sgRNAs. Finally, the sgRNAs were transcribed in vitro using the purified PCR products as the template with the HiScribeTM T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) and following the recommended protocol.