Bacterial and viral DNAs as well as viral RNA were extracted from the nasopharyngeal swabs using RTP® Pathogen kit (STRATEC Molecular, Germany). A multiplex real-time PCR assay allowing the identification of 22 respiratory pathogens (Fast-track Diagnostics respiratory pathogens kit, FTD Luxembourg) was used as previously described [13 (link)]. Following nucleic extraction of EDTA-whole blood samples, another multiplex real-time PCR assay was performed to identify Staphylococcus aureus, Streptococcus pneumoniae and Haemophilus influenzae type b as previously described [14 (link)]. All RNA/DNA amplifications and detections were done using Bio-Rad CFX96 machine (Bio-Rad, USA).
Cfx96 machine
Manufactured by Bio-Rad
Sourced in United States, China, Canada, Japan
The CFX96 machine is a real-time PCR detection system designed for nucleic acid quantification and analysis. It features a 96-well sample block and provides accurate and reliable data for gene expression analysis, SNP genotyping, and other real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (33 mentions)
Trizol, by Thermo Fisher Scientific (32 mentions)
Iscript cdna synthesis kit, by Bio-Rad (15 mentions)
Iq sybr green supermix, by Bio-Rad (12 mentions)
Sybr green pcr master mix, by Bio-Rad (11 mentions)
Rneasy mini kit, by Qiagen (9 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (9 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (6 mentions)
Oligo dt, by Takara Bio (6 mentions)
Chamq sybr qpcr master mix, by Vazyme (6 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Sybr green master mix, by DBI Bioscience (5 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (5 mentions)
Itaq universal sybr green supermix, by Bio-Rad (5 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Sybr green, by Bio-Rad (4 mentions)
Trizol, by Merck Group (4 mentions)
190 protocols using cfx96 machine
1
Multiplex Real-Time PCR for Respiratory Pathogens
2
Quantification of miRNA and mRNA Levels in Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of miRNA levels in mouse neurons, we used Taqman RT and qPCR primers (Applied Biosystems) specific for Y1 scRNA (control), miR-27b-3p, and miR-181a, as previously described [24 (link)] Y1 was used for normalization. For all other RT-qPCR experiments, RNA was extracted from DIV14 mouse or rat neurons using the Qiagen RNeasy Mini kit. qPCR primers used for mouse Trib3, Mex3a, Sox11, Zfp90, Bmi1, and rat Bmi1 are described in Additional file 10 : Table S7. Reverse transcription was done using the iScript cDNA synthesis kit (BioRad). qPCR reactions were run in triplicates with iQ SYBR Green supermix (BioRad) and KiCqStart SYBR Green primers (Sigma). Reactions were performed on the Bio-Rad CFX-96 machine (BioRad) and actin was used for normalization. Luciferase assays were conducted using the Dual-Luciferase Reporter kit (Promega) as described previously [24 (link)]. Luciferase sensors tagged with the 3’UTR of rat Trib3, St8sia2, Mex3a, Sox11, Sh3bp2, Zfp90 and Bmi1 were introduced in rat cortical neurons by nucleofection (Amaxa, Lonza). After a week in culture, firefly and renilla luminescences were sequentially measured and Renilla counts (under 3’UTR control) were normalized to firefly counts.
3
Quantitative Real-Time PCR for Enzyme Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was performed using Bio-Rad CFX96 machine (Bio-Rad, Berkeley, CA,, USA). Briefly, 1 ng of cDNA was added to a reaction mixture containing SYBR™ Green PCR Master Mix (Thermo Fisher Scientific) and selective primers (Table 1 ) for cDNA sequence of drug- and arachidonic acid-metabolizing enzymes. The PCR condition used was as follows: denaturation at 95°C for 3 minutes followed by 40 cycles of denaturation at 95°C for 10 seconds and annealing at 53°C for 30 seconds. The gene expression of the targeted genes was normalized to the expression of the house keeping gene gapdh, as described previously,22 (link) using the following formula: ΔCT = CT (metabolizing gene)−CT (gapdh gene), where Ct is the PCR threshold cycle at which the fluorescence level rises above a baseline. Then, the relative gene expression was calculated as 2−ΔΔCT. The ΔΔCT is the difference of ΔCT between the treated and control group.
4
Muscle COBLL1 Isoform Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze the expression level of COBLL1 alternative splicing isoforms in muscle before and after exercise, real-time quantitative polymerase chain reaction ( RT-qPCR) was conducted by using the BioRad CFX-96 machine (BioRad, Hercules, CA, USA). Primer sequences were designed to detect each type of alternative splicing forms. Two primer pairs, Cobll1a-S (5′-ATCAGTAGACCCGCACGGAA-3′) and Cobll1a-AS (5′-ACACTGACGGAGGAAACCTC-3′) for COBLL1a, and Cobll1b-S (5′-AGGGTCTGTCCAGCCCAGCT-3′) and Cobll1b-AS (5′-CCATAACGTGTGGTCCCTGTCC-3′) for COBLL1b, were used to specifically detect each isoform. Each reaction was executed in a total 25 μL of mixture containing 14 μL of SYBR green master mix, 2 μL of forward primer (5 pmol), 2 μL of reverse primer (5 pmol), 5 μL of distilled water, and 2 μL (50 ng/μL) of cDNA. The PCR conditions were at 94°C for 5 min of pre-denaturation step, 39 cycles of 94°C for 20 s, 56°C for 20 s and 72°C for 30 s, and followed by 72°C for 10 min as a final step. All samples were measured in triplicate to ensure reproducibility, and Ct value was used to calculate the fold change by using the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)). The glyceraldehyde 3-phosphate dehydrogenase gene was used for reference.
5
Quantifying Neuronal miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dissociated hippocampal and cortical neurons from embryonic E18 rat embryos were prepared as described (Fivaz and Meyer, 2005 (link); Kaech and Banker, 2006 (link)). 500,000 neurons were seeded per well in a poly-L-lysine-coated 12-well cell culture plate and transduced with lentiviruses to overexpress gfp, miR-196a, miR-27b, or miR-324 3 h after plating or electroporated with miRIDIAN hairpin inhibitors against miR-27b-5p or miR-324-5p or a negative control inhibitor. Neurons were cultured in Neurobasal media with B27 supplement. Total RNA was extracted from DIV8-14 neurons using Sepasol RNA I Super G according to the manufacturer's instructions (Nacalai Tesque) and 500 μl of Sepasol was added per well. Five nanograms of total RNA was reverse transcribed using the Taqman miRNA RT kit and RT primers specific for Y1 scRNA (control), miR-196a-5p, miR-27b-5p, miR-324-5p from the Taqman miRNA assay (Applied Biosystems). miRNA-specific qPCR probes and Taqman 2× PCR master mix (Applied Biosystems) were used to detect levels of mature miRNAs. qPCR reactions were set up in triplicates according to the manufacturer's protocol and reactions were carried out on the Bio-Rad CFX-96 machine (Bio-Rad). miRNA levels were normalized to the Y1 scRNA.
6
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GeneJET RNA Purification Kit (Thermo Fisher Scientific, Ottawa, Canada) was used for the isolation of total RNA. The specific primers for detection of CXCL1, CXCL2, CCL5, CPT1α, CPT2, PPARα, MCP-1, IL-1β, IL-6, TNF-α, and GAPDH were designed and synthesized by Invitrogen (Shanghai, China). The cDNAs of each sample were synthesized using a PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan). Quantitative PCR was conducted using SYBR Green (Vazyme, Nanjing, China) and a Bio-Rad CFX 96 Machine (Bio-Rad, Hercules, CA). The expression levels of each mRNA were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression levels. The relative expression level was calculated using the 2-ΔΔCT method. The primers are listed in Table 1 .
7
Quantifying Bacterial Chromosome Replication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells fixed in 70% ethanol were collected by centrifugation of 200 μl aliquots at 4°C for 15 min at 15,000g. Cells were washed twice in the same volume of water in order to carefully remove all traces of ethanol before being applied directly as templates in the qPCR reactions. The qPCR was performed using SYBR Premix Ex Taq II (RR820A, Takara Bio Inc., Kusatsu, Japan) in a total volume of 20 μl with 2 μl of template (see above) and 0.4 μM of each primer. The following program was applied in a BioRAD CFX96 machine (Bio‐Rad, Laboratories, Inc., CA, US); 95°C for 30 s, 39 × (95°C for 5 s + 60°C for 30 s), 95°C for 15 s and finally 60°C for 60 s. Origins were quantified using primers that amplified part of the gidA gene (5ʹ‐TTCGATCACCCCTGCGTACA‐3ʹ and 5ʹ‐CGCAACAGCATGGCGATAAC‐3ʹ), whereas termini were detected using primers that amplified part of the dcp gene (5ʹ‐TTGAGCTGCGCCTCATCAAG‐3ʹ and 5ʹ‐TCAACGTGCGAGCGATGAAT‐3ʹ), as previously reported (Riber et al., 2006 ). All ori/ter ratios were normalized to the ori/ter ratio of a sample of wild‐type cells treated with rifampicin and cephalexin where the ori/ter ratio is one.
8
Quantifying mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). For mRNA analysis, 1 μg of total RNA was reverse transcribed using FastQuant RT Kit (TIANGEN, Beijing, China). Next, the real-time PCR was performed using Power SYBR Green PCR master mix (Toyobo, Osaka, Japan), and data were normalized to β-actin expression. The All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) was used to quantitatively measure miRNAs, according to the manufacturer’s protocol, and the relative amount of miRNAs was normalized against U6. All these experiments in triplicate were performed on a Bio-Rad CFX96 machine (Bio-Rad, Hercules, CA, USA), and the fold changes for both miRNA and mRNA were calculated by 2−△△CT method. The primers for miRNA were purchased from Fulengen (Guangzhou, China). The primer sequences used for mRNA detection are listed as follows: IRS1 forward: ACTGGACATCACAGCAGAATGA; and IRS1 reverse: AGAACGTGCAGTTCAGTCAA. FOXO3a forward TGGTTTGAACGTGGGGAACT; and FOXO3a reverse: CAGTTTGAGGGTCTGCTTTGC.
9
Comprehensive mRNA and miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the analysis of mRNA expression, total RNA was isolated using a Hybrid-R Total RNA Purification kit (GeneAll). cDNA was synthesized using the PrimeScript RT Master Mix kit (TaKaRa Bio, Kusatsu, Japan), and quantitative PCR was performed using the qPCR Green 2X master mix (MBiotech, Seoul, Korea) on a Bio-Rad CFX96 machine (Bio-Rad Laboratories). Gene expression was normalized to that of two reference genes (PPIA and RPL13A), and the relative gene expression values were calculated based on the Ct value using the 2-ΔΔCt method [32 (link)]. For the analysis of miRNA expression, total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific) and cDNA was synthesized using the Mir- X™ miRNA First-Strand Synthesis Kit (Clontech Laboratories, Palo Alto, CA, USA). Quantitative PCR was performed using the qPCR Probe 2× Master Mix (MBiotech, Seoul, Korea). The primers used for qRT-PCR are listed in Supplementary Table S1 .
10
Quantifying Gene Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol (Qiagen) following the manufacturer's instructions. RNA was DNAse-treated (Turbo DNA-free AM1907, Ambion). One μg of RNA was reverse transcribed using iScript III (Biorad). Syber green qRT PCR was performed using the BIORAD CFX96 machine. Primers for D-jun, Tax, HBZ, Relish and Diptericin are listed in S1 Table . Individual reactions were prepared using 0.25 μM of each primer, 150 ng of cDNA and the SYBR Green PCR Master Mix in a final volume of 10 μl. PCR reaction consisted of a DNA denaturation step at 95°C for 3 min, followed by 35 cycles (denaturation at 95°C for 15 sec, annealing at 57°C for 60 sec, extension at 72°C for 30 sec). Expression of individual genes was normalized to the housekeeping gene Glyceraldehyde-3-Phosphate dehydrogenase gapdh for mammalian cells and ribosomal protein 49 (Rp49) for Drosophila extracts (S1 Table ). The transcript expression level was calculated according to the Livak method (Livak and Schmittgen, 2001). Each experiment was performed using duplicates from three biological independent experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!