Multiscribe reverse transcriptase high capacity cdna reverse transcription kit

Total RNA was isolated from freshly dissected tissue using the RNeasy kit (Qiagen) and quantified on a Nanodrop UV spectrophotometer. 300–500 ng of total RNA was converted to cDNA using Multiscribe reverse transcriptase (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Inc.). PCR was performed using two primer sets, forward melanopsin primer: 5′-CTGGGCTCCCTACTCCACT with reverse melanopsin primer: 5′-CGTCAGGATGTGCGAGTATC and forward actin primer: ctaaggccaaccgtgaaaag with actin primer: 5′-accagaggcatacagggaca. Amplification products were analyzed on a Qiaxcel capillary electrophoresis system (Qiagen).

Total RNA was transcribed into cDNA using with 25 mM dNTPs Mix, RT random primers, 20 U of RNase inhibitor and MultiScribe Reverse Transcriptase (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA). The qRT-PCR was performed in 10-μL reactions with 5 µL of PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™, Foster City, CA, USA), 50 nM for each set of primers, 2 µL of synthetized cDNA, and water to a final volume of 10 µL. All reactions were carried out using the Real-Time PCR Detection System (CFX96™; Bio-Rad Laboratories, Inc; Richmond, CA, USA). The thermal cycling profile was 50 °C for 2 min, 95 °C for 10 min, 40 cycles at 95 °C for 15 s, and 60 °C for 1 min. Melt curve analysis was carried out to evaluate the specificity of each PCR reaction by detection of one single peak on the dissociation curve profile. The gene relative expression levels were quantified using the (2^−ΔΔct) [33 (link)] method and GAPDH as a reference gene for cDNA normalization. Primer sequences are detailed in Table 2.

A 2.5 mL aliquot of peripheral blood from each patient was collected to PAXgene Blood RNA Tube (QIAGEN BD Company, NJ, USA) at three different time points: prior to resection, 24 h after surgery, and 7 days after resection. Tubes were stabilized in room temperature and frozen at −70°C until RNA extraction. Total RNA was isolated from samples with PAXgene Blood RNA Kit. The integrity of the RNA was established by electrophoresis on agarose precast gel (FlashGel System, Lonza Rockland, ME, USA) and RNA was quantified on NanoDrop spectrophotometer (Eppendorf).
500 ng of total RNA was reverse-transcribed using random primers and MultiScribe Reverse Transcriptase (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA). The reaction mixture was incubated for 10 min at 25°C, then at 37°C for 120 min and for 5 min at 85°C. The quality of cDNA was assessed by the amplification of one of the housekeeping genes: glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or DNA polymerase β(polβ) in the PCR reaction [12 (link)]. Housekeeping genes are expressed constitutively and therefore they reflect the total amount of cDNA in the sample. cDNA was stored at −20°C until use.