To validate OPTN copy number variations duplex real-time quantitative PCR assays were performed on an ABI7900 using TaqMan copy number assay Hs02993339 _cn (OPTN, exon 14) from Life Technology (Life Technologies, Grand Island, NY, USA). For each assay, RNaseP was used as the reference (Life Technologies, Grand Island, NY, USA). To confirm the presence of a partial genomic deletion of OPTN and to confirm the deletion breakpoint, a PCR-based assay was also developed. PCR primers were designed on either side of the deletion breakpoint based on the exact deletion coordinates obtained from whole-genome sequencing analysis of one case by Complete Genomics (Forward: ATTTGGGACCCTGGAATCAT; Reverse: TGTTTTTGGAGGCAACCTTT; approximately 500-bp amplification product).
Abi 7900
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Japan, United Kingdom, Italy
The ABI 7900 is a real-time PCR system designed for high-throughput gene expression analysis. It features a 384-well sample capacity, rapid thermal cycling, and multi-channel detection for up to five fluorescent dyes. The instrument is capable of performing quantitative real-time PCR, allelic discrimination, and relative quantitation assays.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (24 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (15 mentions)
Rneasy mini kit, by Qiagen (9 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (9 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (7 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Takara Bio (5 mentions)
Taqman snp genotyping assay, by Thermo Fisher Scientific (4 mentions)
Rneasy kit, by Qiagen (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Dneasy blood tissue kit, by Qiagen (4 mentions)
Qiaamp dna blood mini kit, by Qiagen (4 mentions)
Rneasy plus mini kit, by Qiagen (4 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (4 mentions)
Sybr green, by Thermo Fisher Scientific (3 mentions)
Power sybr green, by Thermo Fisher Scientific (3 mentions)
Taqman genotyping master mix, by Thermo Fisher Scientific (3 mentions)
Cells to ct kit, by Thermo Fisher Scientific (3 mentions)
Sybr green master mix, by Thermo Fisher Scientific (3 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
158 protocols using abi 7900
1
OPTN Copy Number Variation Validation
2
Quantitative Real-Time PCR Analysis
3
RT-qPCR Protocol following MIQE Guidelines
4
Quantitative Analysis of miRNA and Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cells using Trizol reagent (Applied Biosystems, Invitrogen, USA). The total RNA was reverse transcribed (Takara Bio Inc., Shiga, Japan) according to the manufacturer's guidelines. Primer analysis software (Oligo 7.24, Molecular BiologyInsights, Inc., USA) was used to design specific oligonucleotide primers (Table 4 ). Quantitative real-time RT-PCR was performed using an ABI 7900 (Life Technologies). Reactions were performed in 20 μL of reaction mixture, containing 10 μL PCR master mix (SYBR Premix Ex Taq II; Takara Bio Inc.), 0.4 μL primer pairs, and 2 μL cDNA. After normalizing to the expression of GAPDH, the relative expression levels of hsa-miR-3613-3p and core genes were calculated by the 2−ΔΔCt method.
5
Quantitative Real-Time PCR for Gene Expression
6
Small RNA Library Preparation and Illumina Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Construction of libraries and sequencing on the Illumina HiSeq2500 were performed at the W. M. Keck Center for Comparative and Functional Genomics at the University of Illinois at Urbana-Champaign. Small RNA libraries were constructed from the RNA samples using the TruSeq Small RNA Sample Preparation Kit (Illumina, CA) with two modifications: the final libraries were amplified by PCR for 16 cycles with the Kapa HiFi polymerase (Kapa Biosystems, MA), and the individually-barcoded libraries were mixed into 7 pools and the pools were size selected on Novex 10% TBE gels (Life Technologies) to enrich for small RNAs 18 to 50nt in length. Barcoding involved 8–12 samples sequenced per lane, and was balanced so that equal numbers of samples from group A and B were processed and sequenced in parallel. The final libraries were quantitated by Qubit (Life Technologies) and the average size was determined on an Agilent Bioanalyzer High Sensitivity DNA chip (Agilent Technologies, DE) and diluted to 10 nM. The pooled libraries were further quantitated by qPCR on an ABI 7900 (Life Technologies).
7
DNA Extraction and Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected in tubes containing K2EDTA and stored at −20 °C. DNA was extracted from blood samples using Maxwell 16 Blood DNA Purification Kit (Promega, Milan, Italy). The rs751402 polymorphism was genotyped using a TaqMan SNP Genotyping assay (Life Technologies, Monza, Italy), based on Real Time PCR technique (ABI 7900, Life Technologies). The PCR was carried out in 384-wells plates with a reaction volume of 5 μL containing TaqMan Genotyping Master Mix (Life Technologies), MGB probes and primers and 10 ng of genomic DNA. Primers and probes sequences are property of Life Technologies. Completed PCR plates were analysed using the TaqMan Genotyper Software (Life Technologies).
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cultured cells using RNeasy kits (Qiagen). A nanodrop 8000 photospectrometer was used to measure the yield of RNA extraction (Thermo Scientific). The qScript Flex cDNA kit (Quanta Biosciences, Beverly, MA, USA) was used for reverse transcription (RT) according to the manufacturer's instructions. Quantitative real-time RT-PCR (qRT-PCR) was performed in triplicate on an ABI 7900 (Life Technologies) using the PerfeCTA SYBR Green FastMix ROX (Quanta Biosciences) with 10-μL reactions. Primers were designed to span introns (Supplementary Table S1 ). The transcript amplification results were analyzed with the ABI 7900 HT software (SDS) (Thermo Scientific), and all values were normalized to the levels of the ACTB using the 2−(ΔΔCt) method. Statistical significance of differences in expression levels was assessed by Student's t-test, at α = 0.05.
9
Quantification of ncRNA Expression in Human Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA samples were treated with DNase to remove any contaminant genomic DNA. RNA was then reverse transcribed using Superscript first strand kit (Life Technologies) and the cDNA was diluted and used as template for SYBR Green or TaqMan qPCR on the ABI 7900 (Life Technologies). RNA from human brain, heart, kidney, liver, lung, and muscle was purchased from Life Technologies. Human neurons and astrocytes RNA have been purchased from ScienceCell Research Laboratories, cat# 1525 and cat# 1585 respectively. SERPINE1, TAC1, PGK1 and β-ACTIN TaqMan assays were purchased from Life Technologies. Primers used for SYBR Green qRT-PCR to validate and measure the expression of novel ncRNAs are listed in Supplementary File 7 . Non-coding RNAs expression was measured using Power SYBR Green (Life Technologies). For all qRT-PCR reactions, we included three technical replicates. To compare the expression of genes across different cellular compartment, GraphPad prism software was used to perform ANOVA followed by Tukey post-hoc test. A p value of below 0.05 was considered as statistically significant. The Student’s t-test was used to compare the expression between the normal brain and LOAD.
10
Androgen Receptor Signaling Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 2
LNCaP (ATCC) or LNCaP-EnzR (MR49F is received from Dr. Martin Gleave, University of British Columbia) cells are plated in 96 well plates at 15,000-20,000 cells/well in RPMI+1% csFBS without phenol red. Cells are treated 2 days after plating and harvested 18 hours after treatment (for TMPRSS2) or 24 hours after treatment (for PSA and FKBP5). RNA is isolated (cells to ct kit, Life Technologies), cDNA synthesized (cells to ct kit), and expression of TMPRSS2, PSA or FKBP5 and expression of GAPDH are measured using realtime PCR primers and probes (TaqMan probes, Life Technologies) by realtime PCR (ABI 7900, Life Technologies). Relative expression is calculated using ddct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!