Rna nano kit
The RNA Nano kit is a laboratory product designed for the analysis and quantification of RNA samples. It provides a standardized method for assessing the quality and concentration of RNA, which is essential for various downstream applications in molecular biology and genetics.
Lab products found in correlation
41 protocols using rna nano kit
RNA-Seq of Sorted Cell Populations
Synchronous Predatory Infections of Bdellovibrio
CaCl2 25 mM HEPES pH7.6), or strain S17-1 suspended in Ca/HEPES
alone, were set up as previously described36 (link) with samples throughout the timecourse being taken and total RNA
isolated from them. This semi-quantitative PCR allows the evaluation of specific
predator transcripts in the presence of fluctuating levels of prey RNA as the
predator degrades it. RNA was isolated from the samples using a Promega SV total
RNA isolation kit with the RNA quality being verified by an Agilent Bioanalyser
using the RNA Nano kit. RT-PCR was performed with the Qiagen One-step RT-PCR kit
with the following reaction conditions: One cycle 50°C for 30 minutes,
95°C for 15 minutes, then 25 cycles of 94°C for 1 min, 50°C
for 1 min, 72°C for 1 min, a 10 minutes extension at 72°C after
the 30 cycles, and finally a 4°C hold. Two independent repeats were
carried out. Primers to anneal to bd0886 were
5’-AGCCTCTACATGGGTGCAAG -3’ and 5’- AACTTGGCTGCATACCAACC
-3’. Primers to anneal to bd1176 were
5’-GCCAACGCCAGCGTGAATGC-3’ and
5’-GGCCGTCGTTGAGTTGCTGC-3’.
Bdellovibrio predation on E. coli: Gene expression
RT-PCR Analysis of Bdellovibrio Predation
RT-PCR was carried out using the Qiagen One-step RT-PCR kit under the reaction conditions: one cycle 50 °C for 30 mins, 95 °C for 15 mins, then 25 cycles of 94 °C for 1 min, 48 °C for 1 min, 72 °C for 2 mins, and finally a 10 mins extension at 72 °C. Primers are listed in Table
Quantifying Yellow Fever Virus RNA
Transcriptional Profiling of Transposon Mutants
Newt Knee Joint RNA Extraction
Transcriptome Analysis of Cortical Development
Genome-wide miRNA Profiling in Whole Blood
RNA-seq Library Preparation and Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!