Ktaprime

GST-nephrin fusion proteins were generated by cloning the nephrin gene or gene fragments into the pGEX-4 T-1 vector. The constructs were transformed into Escherichia coli BL21 (Novagen, Merck, Nottingham, UK), and expression of the recombinant proteins was induced by isopropyl-β-d-thiogalactoside. The GST-nephrin fusion proteins were subsequently purified from bacterial extracts by affinity chromatography using glutathione-sepharose (ÄKTAprime; GE Healthcare, Freiburg, Germany) according to the manufacturer's protocol. Recombinant GST-tagged β-arrestin2 was purchased from Abnova (Heidelberg, Germany), and ATF2 was obtained from Sigma-Aldrich/Merck.

Refolded hGH protein after solubilization in freeze–thaw-based buffer in the presence of DTT was incubated at 4°C for different time intervals, i.e., 1, 4, 8, 16, and 24 h. The refolded protein after every time interval was centrifuged at 12,000 rpm, 4°C for 30 min, and 4 ml of the supernatant was loaded onto 20 mM Tris–HCl pre-equilibrated size exclusion chromatographic column Superdex 200 PG 16/600 (GE Healthcare, United Kingdom) connected with ÄKTA prime (GE Healthcare, United Kingdom). Washing, equilibration, and elution were performed at a flow rate of 2 ml/min. The graphs from different time intervals were overlaid and the area under the curve was determined.

Competent E. coli M15 (Promega) were transformed with the pQE 30 vector containing the potD, pdT or potD-pdT gene fragments; this vector inserts an N-terminal histidine tag to facilitate the purification. Protein expression was induced in the mid-log-phase cultures by 1 mM IPTG (Sigma). The recombinant proteins were purified from the soluble fraction through affinity chromatography with Ni²⁺ charged chelating sepharose resin (HisTrap Chelating HP; GE HealthCare) in an Äkta Prime (GE HealthCare) apparatus. Elution was performed with 300 mM imidazole.
To remove the lipopolysaccharide (LPS) resulting from the proteins’ production in E. coli, a wash step was performed consisting in treating 1 mL of purified recombinant proteins (rPotD, rPdt and rPotD-PdT) with 10 μL of TritonX^®-114 for 30 min at 4°C, followed by incubation at 37°C for 10 min. After centrifugation at 10,600 x g for 10 min at 25°C, the supernatant containing the proteins was removed and transferred to a sterile tube. This washing sequence was repeated 3 times [36 (link)]. After three washes, the recombinant proteins were quantified by the Bradford method (BioRad Protein Assay Kit) and stored at -20°C.

The open reading frame of Nrx was amplified by PCR from mouse cDNA using the oligonucleotides 3′catatgtcgggcttcctggag5′ and 5′ggatccactagatgggctcaggc3′. Following A-tailing, the PCR product was ligated into the pGEM-T vector (Promega, Madison, USA) and was further subcloned by restriction ligation into the expression plasmid pET15b (Novagen, Darmstadt, Germany). For the intermediate trapping experiments, the more C-terminal active site cysteinyl residue of mouse Nrx was exchanged for a seryl residue (changing the Cys-Pro-Pro-Cys active site to Cys-Pro-Pro-Ser) by site-directed mutagenesis as described before in [13 (link)] using specific oligonucleotides (3′gtgtccacccagccgaagcc5′ and 5′taaggcttcggctgggtggac3′). Following the sequence analysis, the plasmid was transformed into the E. coli strain BL21(DE3)pRIL. Mouse Nrx Cys208Ser was expressed as a polyhistidine-tagged fusion protein in E. coli and was purified using the immobilized metal affinity chromatography technique and FPLC (ÄKTAprime, GE Healthcare, Uppsala, Sweden) as described before in [5 (link)]. The expression and purification efficiency was analyzed by SDS PAGE.

Detailed methods for phage display and purification of soluble Fab were described previously [49 (link)]. For panning, the wells of an ELISA plate were coated with 7 µg/mL recombinant human DR4 in phosphate-buffered saline (PBS; pH 7.4). Sequence analysis was performed using the National Center for Biotechnology Information IgBLAST program (https://www.ncbi.nlm.nih.gov/projects/igblast/).
Protein expression of DR4-4 Fab containing (His)₅ tag was induced in Escherichia coli and purified using an ÄKTAprime plus instrument with a HisTRAP column (GE Healthcare, Uppsala, Sweden). The purified Fab was visualized through immunoblotting using anti–human IgG (Fab specific) Ab and Coomassie blue staining.