Cfx96 touch real time detection system

SHSY-5Y cells were grown and treated as indicated in figure legends. After treatment , total RNA was extracted from cells using the RNEasy kit (Qiagen) according to the manufacturer’s instructions. One microgram was used for cDNA synthesis by QuantiTect Reverse Transcription kit (Qiagen). The primers for RT-PCR reactions are listed in Supplementary Table ST1. Quantitative real-time PCR was performed by using iQ SYBR Green Supermix on the CFX96 Touch Real-Time Detection System (Bio-Rad Laboratories). Samples were heated for 3 min at 95 °C and amplified in 39 cycles for 11 s at 95 °C, 45 s at 60 °C with last cycle of 10 sec at 95 °C, 5 s at 65 °C and 5 sec at 95 °C. Analyses were conducted using CFX manager software (Bio-Rad) and the threshold cycle (CT) was extracted from the PCR amplification plot. Relative gene expression was determined using the ΔΔCT method, normalizing to vehicle (DMSO). The change in mRNA levels of the genes was expressed in fold change as previously described45 (link).

Genomic DNA was isolated from peripheral blood cells using the Maxwell 16 LEV Blood DNA Kit (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instructions. DNA concentration and purity were determined using the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
For polymorphism detection, we used the TaqMan SNP Genotyping Assay (Applied Biosystem, Waltham, MA, USA), which specifically recognises each single polymorphism (Assay ID: C_30633851_20; C_11985548_10; C_11372171_10; C_27530948_10).
Each genotyping assay contained two sets of primers, in order to amplify the sequence of interest, and two TaqMan probes labelled with two different dyes at the 5′ end: one probe specific for the wild-type (WT) allele and the other for the SNP variant.
PCR was performed in a CFX96 Touch Real Time Detection System (BioRad, Hercules, CA, USA), and the CFX Maestro Software was used to identify samples with different genotypes. The software displays the data as Relative Fluorescence Unit (RFU) for Allele 1/Allele 2 of each sample compared to No Template Control (NTC).
Samples that showed heterozygous or homozygous allele for the genetic variant were confirmed with PCR amplification followed by specific enzymatic digestion (RFLPs) or with direct sequencing of the amplified fragment.

Viral RNA was extracted from 200 μL of serum specimens using a QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The viral RNA was eluted in 50 μL of nuclease-free water and stored at −80 °C until analysis. The DENV serotyping was detected by Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) kit (Sacace Biotechnologies, Como, Italy) on the CFX96 Touch Real-Time Detection System (Bio-Rad) using previously described primer pairs and protocols [13 (link)].

Total RNA from pituitary and hypothalamus were extracted using Trizol reagent (Invitrogen). RNA concentrations were determined by NanoPhotometer^® N120 (IMPLEN). After reverse transcription using Super ScriptTM III Reverse Transcriptase (Invitrogen) from 1µg mRNA, 4 µL cDNA dilution (1:10) were added to 10µL iTaq Universal SYBR Green Supermix (BioRad, USA) and 0.5 mM of each specific pair primer.

Tpcn1 forward primer 5′CTGTCCTCTGGATGGAACCT3′;

Tpcn1 forward primer 5′CTGTCCTCTGGATGGAACCT3′;

Tpcn2 forward primer 5′CCCTGGCTGTATACCGATTG3′;

Tpcn2 reversed primer 5′GTCCCAGAGCGACAGTGG3′;

GAPDH forward primer 5′TGACGTGCCGCCTGGAGAAA3′;

GAPDH reversed primer 5′AGTGTAGCCCAAGATGCCCTTCAG3′ and then were amplified on a CFX96 Touch Real-Time detection system (BioRad) under the following conditions: 10-min denaturation step at 95 °C was followed by 40 cycles of denaturation at 94 °C for 10 s and annealing/extension at 60 °C for 30 s. The results were normalized to GAPDH, and relative mRNA levels were calculated using the ΔΔCt method and reported as fold change (relative to WT).

Total RNA was extracted from nasal mucosal tissues using TRIzol reagent (Invitrogen, Shanghai, China) according to the manufacturer’s protocols. The obtained RNA was reverse-transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen). The expression of OPA1, Mfn1, Drp1, and Fis1 were quantified from synthesized cDNA using a SYBR Green assay on a CFX96 Touch™ Real-Time Detection System (Bio-Rad, Hercules, CA, USA). All primers were synthesized by Invitrogen, and their sequences are presented in Table 1. β-actin was used as an endogenous reference. Relative quantitation values (2-^ΔΔCt) were expressed as fold-change over the controls.