Log In Sign up
The largest database of trusted experimental protocols

Anti stat5 sc 835

Manufactured by Santa Cruz Biotechnology
Visit Supplier
Sourced in United Kingdom

Anti-STAT5 (sc-835) is a lab equipment product manufactured by Santa Cruz Biotechnology. It is a primary antibody that recognizes the STAT5 protein, a transcription factor involved in various cellular processes. This product can be used for applications such as western blotting, immunoprecipitation, and immunohistochemistry, among others.

Automatically generated - may contain errors

Lab products found in correlation

Anti stat1, by Cell Signaling Technology (1 mentions) Anti phospho stat1 tyr701, by Cell Signaling Technology (1 mentions) Anti phospho mek1 2 ser217 221, by Cell Signaling Technology (1 mentions) Anti β actin ab6276, by Abcam (1 mentions) Newblot nitrocellulose stripping buffer, by LI COR (1 mentions) Anti phospho stat5 tyr694, by Cell Signaling Technology (1 mentions) Anti α tubulin, by Cell Signaling Technology (1 mentions) Mini protean precast gel, by Bio-Rad (1 mentions) Anti jak2, by Cell Signaling Technology (1 mentions) Anti erk1 2, by Cell Signaling Technology (1 mentions) Odyssey infrared imaging system, by LI COR (1 mentions) Anti mek1 2, by Cell Signaling Technology (1 mentions) Nitrocellulose membrane, by Bio-Rad (1 mentions) Sonicator, by Qsonica (1 mentions)

Spelling variants of this product

STAT5 (34 citations) Anti-STAT5 (23 citations) STAT5 (sc-835) (5 citations)

3 protocols using anti stat5 sc 835

1

Western Blot Analysis of JAK2 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Leukemic cells were lysed in lysis buffer supplemented with freshly added protease and phosphatase inhibitors. 25μg (BCA method; Thermo Scientific) lysate was loaded on 10% mini protean precast gels (BioRad, Veenendaal, Netherlands), and transferred to a nitrocellulose membrane (Biorad). Primary antibody incubation was performed according to manufacturer's protocol. Anti-JAK2 (#3230), anti-phospho-JAK2-Tyr1007 (#4406), anti-phospho-STAT5-Tyr694 (#9351), anti-phospho-STAT1-Tyr701 (#9167), anti-Stat1 (#9175), anti-phospho-MEK1/2-Ser217/221 (#9154), anti-MEK1/2 (#4694), anti-phospho-Erk1/2-T202/204 (#4370), anti-Erk1/2 (#91078), and anti-αTubulin (#2144) were obtained from Cell Signaling Technology (Danvers, Massachusetts, USA). Anti-β-actin (ab6276) was obtained from Abcam (Cambridge, UK), and anti-STAT5 (sc-835) from Santa Cruz (Heidelberg, Germany). Blots were stained with secondary antibodies (IRDye 680RD- or 800CW-labelled anti-rabbit and IRDye 680RD- or 800CW-labelled anti-mouse; Li-Cor Biosciences, Leusden, Netherlands) and scanned using the Odyssey infrared imaging system (Li-Cor Biosciences). To reprobe membranes, they were stripped in NewBlot Nitrocellulose stripping buffer (Li-Cor Biosciences) according to manufacturer's protocol. BCR-JAK2, PAX5-JAK2 and TERF2-JAK2 proteins were separated from wildtype JAK2 based on size (~94, 57, 95 and 125 kDa, respectively).
Steeghs E.M., Jerchel I.S., de Goffau-Nobel W., Hoogkamer A.Q., Boer J.M., Boeree A., van de Ven C., Koudijs M.J., Besselink N.J., de Groot-Kruseman H.A., Zwaan C.M., Horstmann M.A., Pieters R, & den Boer M.L. (2017). JAK2 aberrations in childhood B-cell precursor acute lymphoblastic leukemia. Oncotarget, 8(52), 89923-89938.
+ Open protocol
+ Expand
2

Protein Interaction Analysis by Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lysates, immunoprecipitations and western-blotting were performed as previously described [32 (link), 33 (link)]. Anti-CDK4 (cst-2906), anti-CDK6 (cst-3136), anti-SRC (cst-2110), anti-phospho-STAT5-Y694 (cst-9351), anti-phospho- FLT3-Y591 (cst-3466) and anti-phospho-SRC-Y416 family (cst-2101) were from Cell Signaling Technology. Anti-LYN (sc-7274), anti-FLT3 (sc-480), anti-ERK2 (sc-154), anti-HCK (sc-72), anti-FYN (sc-28791) and anti-STAT5 (sc-835) were from Santa Cruz Biotechnology.
Lopez S., Voisset E., Tisserand J.C., Mosca C., Prebet T., Santamaria D., Dubreuil P, & Sepulveda P.D. (2016). An essential pathway links FLT3-ITD, HCK and CDK6 in acute myeloid leukemia. Oncotarget, 7(32), 51163-51173.
+ Open protocol
+ Expand
3

STAT5 Chromatin Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed as described (21 (link)). Briefly, cells were fixed in 1% formaldehyde for 10 min, sonicated using a Qsonica sonicator, and lysates were immunoprecipitated overnight with normal rabbit IgG (Caltag, Burlingame, CA) and anti-STAT5 (sc-835; Santa Cruz Biotechnology). Quantitative PCR was performed in triplicate using primers for CSF2RA (TTTGCATGTGGTCTTTGAGG and TTCTTGACAACACCCAGCAC), CisH (CCCGCGGTTCTAGGAAGAC and CGAGCTGCTGCCTAATCCT), Socs2 (AGGCCGATTCCTGGAAAG and CGACGAGACTTGGCAAGAG), CD83 (CTGGCCCTCAAATTCTTTCA and TGAGACGTTAGCCAGTGGAA), CD80 (CCAAATCTTCACCCCACCTA and CTGAGGAAAAGCGAATGGAA) or rhodopsin (TGGGTGGTGTCATCTGGTAA and GGATGGAATGGATCAGATGG). The results were normalized to the input and expressed relative to binding to the rhodopsin-negative binding region. Match Browser (http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi) and the UCSC Genome Browser (http://genome.ucsc.edu) were used to identify potential STAT5 binding sites in the regulatory region of genes.
Toniolo P.A., Liu S., Yeh J.E., Moraes-Vieira P.M., Walker S.R., Vafaizadeh V., Barbuto J.A, & Frank D.A. (2015). Inhibiting STAT5 by the BET bromodomain inhibitor JQ1 disrupts human dendritic cell maturation. Journal of immunology (Baltimore, Md. : 1950), 194(7), 3180-3190.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!