Total DNA was collected from freshly egressed parasites using the DNeasy blood and tissue kit (Qiagen). The mtDNA copy number was determined by real-time polymerase chain reaction using primers 3 and 4 for Cox3 and 5 and 6 for Cyb (S1 Table ) and following manufacturer’s instructions for the Fast SYBR Green Master Mix (Applied Biosystems, Thermo Fisher Scientific, Vilnius, Lithuania). As control for nuclear DNA we used primers 13 and 14 for CDPK3 (S1 Table ). The quantity of DNA was normalized to the expression of the nuclear Toxoplasma alpha tubulin (TUBA1) gene using primers 15 and 16 (S1 Table ). The baseline and threshold (Ct) was determined by the Sequence Detection System software imbedded into the Applied Biosystems program and verified manually. The relative amount of mtDNA was calculated using the ΔΔCt method. Specifically: ΔΔCt = ΔCT(target sample) − ΔCT(parental); where ΔCT = CT(target gene)−CT(TUBA1). Finally, the relative DNA amount was expressed as 2ΔΔCT.
Sequence detection system software
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Sequence Detection System software is a tool designed to analyze and interpret data generated by real-time PCR instruments. It provides the core functionality for data collection, analysis, and reporting during real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
7500 real time pcr system, by Thermo Fisher Scientific (6 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (5 mentions)
Sybr green, by Thermo Fisher Scientific (5 mentions)
Rneasy plus mini kit, by Qiagen (5 mentions)
High capacity cdna reverse transcriptase kit, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taqtm, by Takara Bio (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
7500 system, by Thermo Fisher Scientific (4 mentions)
7900ht fast real time thermocycler, by Thermo Fisher Scientific (3 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nucleospin rna kit, by BD (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Transzol up plus rna kit, by Transgene (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Custom sybr probes, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Mircury rna isolation kit, by Qiagen (2 mentions)
63 protocols using sequence detection system software
1
Determination of Mitochondrial DNA Copy Number
2
Quantitative Real-Time PCR Analysis of PKD1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy kit (Qiagen, Frederick, MD) and 500 ng total RNA each sample was converted to cDNA using the High Capacity cDNA Reverse Transcriptase kit (Applied Biosystems, Bedford, MA). Quantitative real-time PCR was performed with a 7900HT Fast real time thermocycler (Applied Biosystems) and the TaqMan Universal PCR Master Mix (Applied Biosystems). The reaction included 10 ng cDNA as template and primer sets from Applied Biosystems (Hs00177037_m1 and Hs02758991_g1). Conditions: 95 °C for 20 seconds; 40 cycles of 95 °C for 1 second and 60 °C for 20 seconds. Data were collected by a Prism 7900 sequence detector and analyzed with Sequence Detection System software (Applied Biosystems). Data were normalized to human GAPDH, and mRNA levels of PKD1 were calculated using the ΔΔCT method and plotted as relative fold to the respective control.
3
Quantification of Transplanted Cell RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the differentiated and transplanted cells and the different tissues by using MiniBEST Universal RNA Extraction Kit (TaKaRa) at different time points after differentiation and cell transplantation. The transplanted cells in the scraped area of corneal endothelium were indicated by the 7 mm ring drill, and subsequently collected for qPCR detection. cDNAs were synthesized using a Primescript RT Reagent Kit (TaKaRa) according to the manufacturer’s protocol. Real-time PCR was carried out using SYBR Green reagents on an Applied Biosystems 7500 Real Time PCR System (Applied Biosystems). The cycling conditions were 10 seconds at 95°C followed by 40 two-step cycles (15 seconds at 95°C and 1 minute at 60°C). The quantified data were analyzed using Sequence Detection System software (Applied Biosystems) with GAPDH or actin as internal control (Table 2 ).
4
Quantitative RT-PCR for mRNA Abundance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two-step quantitative reverse transcriptase-mediated real-time PCR (qPCR) was used to measure the abundance of individual mRNAs. RNA was extracted from cells with the RNAqueous kit as detailed by the manufacturer (Ambion). Equal aliquots of total RNA from samples were converted to cDNA with the High-Capacity cDNA Archive kit (Applied Biosystems), and qPCR reactions were performed in triplicate with 10 ng of cDNA and the TaqMan Universal PCR master mix (Applied Biosystems). All primer/probe sets were purchased from Applied Biosystems. All amplification data were collected with an Applied Biosystems Prism 7900 sequence detector and analyzed with Sequence Detection System software (Applied Biosystems). Data were normalized to the endogenous control POLR2A [34 (link)], and mRNA abundance was calculated using the ΔΔCT method [33 (link)].
5
Quantitative real-time PCR analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of forward and reverse primers for FOXO3 (NM_001455), HIF-1A (NM_181054), and MEF2A (NM_001171894) were as follows: FOXO3 (forward) 5΄-ACA TGG GCT TGA GTG AGT CC-3΄ and (reverse) 5΄-GCC TGA GAG AGA GTC CGA GA-3΄; HIF1A (forward) 5΄-TGC ATC TCC ATC TCC TAC CC-3΄ and (reverse) 5΄-CCT TTT CCT GCT CTG TTT GG-3΄; and MEF2A (forward) 5΄-TCA GCT CTC TTG TTG CTG GA-3΄ and (reverse) 5΄-AAA TCG GTT CGG ACT TGA TG-3΄. The forward primer sequence for GAPDH (NM_002046) was 5΄-GGT CTC CTC TGA CTT CAA CA-3΄, and the reverse primer sequence was 5΄-AGC CAA ATT CGT TGT CAT AC-3΄. Total RNA (1 µg) was reverse transcribed to cDNA according to the manufacturer’s instructions (M-MLV Reverse Transcriptase; Invitrogen, Carlsbad, CA). Reactions were carried out on an ABI Prism® 7900HT Sequence Detection System (PE Applied Biosystems, Foster City, CA), and relative transcript levels were determined using GAPDH as the endogenous control (SYBR Green method). Each reaction was performed in triplicate. Thermal cycling conditions were 95°C for 10 minutes followed by 45 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 20 s. Data were analyzed using the Sequence Detection System software (SDS version 2.0, PE Applied Biosystems).
6
Quantitative Real-Time PCR Analysis of Huntingtin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cultured cells was extracted using the mirvana miRNA Isolation Kit (Life Technologies) according to the manufacturer’s manual. cDNA of the sample was synthesized by reverse transcription with SuperScript VILO cDNA Synthesis kit (Invitrogen, CA). In real-time PCR analysis, the cDNA was amplified with specific TaqMan Gene Expression Assays (Rn00577462_m1 for rat Htt) (Applied Biosystems, MA) by ABI prism 7000 Sequence Detection System (Applied Biosystems). The Ct value of Htt mRNA was obtained using Sequence Detection System software (Applied Biosystems) and normalized with rat GAPDH control (4352338E) (Applied Biosystems).
7
Corneal Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Corneal total RNA was extracted using the TransZol Up Plus RNA kit (TransGen Biotech) and quantified using the NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA was synthesized using a One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech) according to the manufacturer's instructions. Subsequently, qPCR was conducted with the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and the Rotor-Gene Q system (Qiagen, Hilden, Germany). The cycling conditions were set as follows: 3 minutes at 95°C followed by 40 two-step cycles (5 seconds at 95°C and 30 seconds at 60°C). The data were analyzed with the Sequence Detection System software (Applied Biosystems, Waltham, MA, USA) using Gapdh as the reference gene. The primers are listed in Table .
8
Quantification of Plasma cfEBV DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood (3.0 mL) was collected from each patient at the following timepoints: within 2 weeks before treatment initiation; 17~21 days after NAC completion and before the initiation of CRT, within 3 months after CRT completion. Plasma cfEBV DNA was quantified with RT-qPCR targeting the BamHI W fragment of the EBV genome as described by Lo et al. [45 (link)]. The sequences of the forward and reverse primers were CCCAACACTCCACCACACC and TCTTAGGAGCTGTCCGAGGG, respectively. A dual fluorescently labelled oligomer, 5′-(FAM) CACACACTACACACACCCACCCGTCTC (TAMRA)-3′ served as the probe. Amplifications were performed in an Applied Biosystems 7700 Sequence Detector and analyzed using Sequence Detection System software (version 1.6.3) developed by Applied Biosystems. The plasma EBV DNA concentration was calculated as previously described [45 (link)]. All samples were analyzed in duplicate and were re-tested a third time if the first two tests yielded varying results. The operators who measured the ctDNA were blinded to the patient information and clinical outcomes.
9
Rat Spinal Cord Pro-inflammatory Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat thoracic spinal cord samples were harvested as described above. RNA extraction was performed using TRIzol (Gibco; Thermo Fisher Scientific, Inc.), and oligo(dT) primer and SuperScript II reverse transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.) were used in cDNA RT. The mRNA expression levels of the pro-inflammatory cytokines interleukin (IL)-6, IL-1β and tumor necrosis factor (TNF)-α were assessed by RT-qPCR. The protocol was performed according to a previous report (18 (link)): 3 min at 9°C, followed by 45 cycles of 10 sec at 95°C for denaturation, and 45 sec at 60°C for annealing and extension. All experiments were repeated twice, and PCR reactions were triplicate in each test. Target cDNA quantities were evaluated from the quantitation cycle number (Cq) (20 (link)) using Sequence Detection System software (version 2.4.1; Applied Biosystems; Thermo Fisher Scientific, Inc.). Primer sequences are provided in Table I . GAPDH served as an endogenous internal standard control.
10
qRT-PCR Analysis of Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!