Quantstudio 5 real time pcr system

After the isolation of total DNA as described above, the copy number of mtDNA in each DNA sample was measured by coamplifying the mitochondrial D-loop (mtD-loop) and beta actin (ACTB) genes by quantitative PCR using the QuantStudio 5 Real-Time PCR System and the SYBR Green reagent (#Q311-02; Vazyme). The following primer sequences were used: mtD-loop sense primer GATCGTACATAGCACATATCATGTC and anti-sense primer GGTCCTGAAGTAAGAACCAGATG and ACTB sense primer CCCCTCCTCTCTTGCCTCTC and anti-sense primer AAAAGTCCTAGGAAAATGGCAGAAG. The 2^-ΔΔCt method was performed to calculate the copy number of mtDNA [20 (link)].

The expression of stress-related flavonoid-related genes was measured by qRT-PCR in WT and transgenic lines of A. thaliana or apple calli. Total RNA was extracted from A. thaliana leaves or apple calli using the RNAprep Pure Plant Kit (Tiangen, Beijing, China). First-strand cDNA was synthesized using the PrimeScript™II 1st Strand cDNA Synthesis Kit (Clontech TaKaRa, Beijing, China). Quantitative RT-PCR was conducted using the ChamQ SYBR Color qPCR Master Mix Kit (Vazyme, Shanghai, China) with a QuantStudio™ 5 Real-Time PCR System. Each reaction was performed in triplicate, and data were analyzed as previously described [55 (link)]. Atactin1 (At2g37620) or MdActin (XM_029088423.1) was used as an internal control. All the quantitative PCR primers are listed in Table S1.
In addition, the expression level of mature miR156 was confirmed by stem-loop RT-PCR as described [56 (link)]. The cDNA synthesis was performed using the prime script first strand cDNA Synthesis Kit (Takara, China), according to the manufacturer’s instructions, using a stem-loop RT primer instead of an oligo (dT) primer (Table S1). Subsequently, PCR was performed to detect the expression level of miR156 using the miR156-specific forward primer and the stem-loop-specific reverse primer (Table S1). The apple 5.8S rRNA (GenBank accession no. AF186480) was used as a reference gene.

Total RNA was extracted using the RNA Simple Total RNA Kit (Tiangen, Beijing, China), according to the manufacturer’s protocol, and 1 μg of total RNA was reverse-transcribed to cDNA, using the Fast Quant RT Kit (with gDNase) (Tiangen, Beijing, China). The gene expression was quantitatively analyzed by RT-qPCR in a QuantStudio™ 5 Real-Time PCR System, using the AceQ qPCR SYBR Green Master Mix (Low ROX Premixed; Vazyme, Nanjing, China), gene-specific primers (Table 1), and cDNA as a template. The cycling conditions were as follows: 95 °C for 5 min; followed by 40 cycles of 95 °C for 10 s; and 60 °C for 30 s. The Ct values were obtained using the default settings, and the relative mRNA expression of the target genes was calculated using the ^−2ΔΔCt method after normalization to the levels of GAPDH (a constitutively expressed gene that was used as the internal control) [30 ].