Anti fluorescein pod

Whole-mount in situ hybridization assays were executed in strict adherence to previously published protocols (Ning et al., 2013 (link)). In dual-color fluorescence in situ hybridization, anti-Digoxigenin-POD (11633716001, Roche) and anti-Fluorescein-POD (11426346910, Roche) were deployed as the primary antibodies to discern Digoxigenin-labeled mCherry probes and Fluorescein-labeled cxcl12a or cxcr4b probes, respectively. Subsequent analysis was performed utilizing the Perkin Elmer TAS fluorescein system (NEL701A001KT) as delineated in earlier publications (Mao et al., 2019 (link)). The composite in situ hybridization images display the following annotations: upper left quadrant designates the genotype, upper right indicates developmental stage, lower left specifies the probe in use, and the lower right reveals the aggregate count of representative samples alongside detected samples.

Double fluorescence in situ hybridization on cryosections were performed using fluorescein- and DIG-labeled probes. After hybridization, slides were washed, quenched and blocked. Probes were detected by incubation with anti-fluorescein-POD and anti-DIG-POD (Roche; 1:200), followed by Cy3- and Cy2-tyramide-labeled fluorescent dyes (according to the instructions of the TSA Plus Fluorescent Systems Kit, PerkinElmer). tdTomato antisense probe was generated using the following primers: forward, tcccacaacgaggactacaccat; reverse, cgcgcatcttcaccttgtagatca. The Col1a1 probe was a 183 bp fragment of the carboxyl propeptide domain. The extended protocol is described elsewhere (Shwartz and Zelzer, 2014 (link)).

Dual-label ISH protocol referred to our previous study [38 (link)]. The Vasa probe was 1040 bp and synthesized using Fluorescein RNA labeling kit (Roche). Gonadal sections were pre-hybridized for 2 h, then hybridized by 1 µg/mL Vasa probe and one of EcPou5f1 and EcNanog probes at the same time at 65 °C for 15 h. Subsequently, sections were washed with SSC and blocked with Blocking Reagent for at least 1 h. The Vasa probe was incubated with anti-Fluorescein-POD (Roche), then stained red fluorescence for 10 min with TSA^TM PLUS Fluorescein system (PerkinElmer, Shelton, USA). After being washed, the EcPou5f1 or EcNanog probes were incubated with anti-Digoxigenin-POD (Roche) and were stained green fluorescence for 10 min. Finally, gonadal sections were counterstained by DAPI (Solarbio) for cell nuclei staining. Sections were imaged with a Zeiss LSM 800 microscope (Zeiss, Jena, Germany) or a Leica TCS SP5 microscope (Leica).

CRM activity was assessed in embryos from transgenic flies using fluorescent in situ hybridization as described previously [101] (link). The following ESTs or full length cDNAs from the Drosophila Gene Collection (DGC) were used to generate probes: RE13967 (bap), RE40937 (doc2), RE20611 (dpp), GM04312 (dTCF), SD02611 (pnr) and AT15089 (twi). cDNAs used for bin and tin, lacZ, Mef2 and pnt were generous gifts from M. Frasch, U. Elling and M. Taylor respectively. Double or triple in situ hybridizations were performed using anti-fluorescein-POD, anti-DIG-POD and anti-biotin-POD antibodies (Roche, 1∶2000 dilution) and were developed sequentially with Cy3, fluorescein, and Cy5 tyramide signal amplification reagents (Perkin Elmer TSA kit). The lacZ expression patterns were imaged using Zeiss LSM 510 FCS or LSM 510 META confocal microscopes with A-Plan 10×/0.25 PH1 objective.

Double-label in situ hybridization was performed using antisense digoxigenin (DIG) RNA probes to guidance genes and fluorescein-labeled probes to OR subfamily genes as previously described [36 (link), 64 (link)], with the exception that RNase treatment was not performed after probe removal. Following probe hybridization and removal, embryos were incubated in anti-DIG-POD (1:500; Roche, 11207733910) and the DIG label was amplified using the cyanine 5-coupled tyramide kit to label axon guidance genes. OR transcripts were detected using anti-fluorescein-POD (1:500; Roche, 11426346910) and the fluorescein label was amplified using a fluorescein-coupled tyramide kit (PerkinElmer, NEL741001KT). Propidium iodide labeling and imaging were performed following the second tyramide amplification [75 ]. The plasmids used to make probes targeting nrp1a and nrp1b were as described by Dell et al., 2013 [76 (link)] and Taku et al., 2016 [64 (link)]. For robo2 (refseq accession number NM_131633.1, nucleotides 3445–4382) and pcdh11 (refseq accession number XM_005173190.3 nucleotides 220–839) sequences were amplified from 48hpf zebrafish cDNA and cloned into pcRII-TOPO Dual promoter TA cloning kit (Invitrogen, K460001) for probe synthesis. Full-length probes were used in all hybridization experiments except for robo2 where the probe was hydrolyzed prior to incubation.