Psico

The GFAP promoter was a gift kindly provided by Dr. Michael Brenner. Lentiviral vector of GFAP promoter-driven ^DNIκBα was generated by subcloning GFAP promoter into ^DNIκBα expressed lentiviral vector. Mouse BDNF shRNA and control scramble shRNA were constructed using pSico (Addgene). BDNF shRNA sequence: 5′-GAATTGGCTGGCGATTCAT-3′. Lentiviruses were produced by co-transfecting the viral expression vector with the packaging plasmids into HEK293T cells. At 24–36 hours after transfection, culture media were collected and filtered through a 0.45-μm filter to remove cell debris and followed by ultracentrifugation. After centrifugation, supernatant was removed, and lentiviruses in the pellet were re-suspended, and lentivirus titer was determined via ELISA kit (Clontech Laboratories).

The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively. Full-length human CLASP2α (National Center for Biotechnology Information reference sequence NM_015097.2) was PCR amplified from a full-length cDNA clone (IMAGE clone 9021646; BC140778) and subcloned into pCAG and pEGFP-C1 (Clontech). In addition, we obtained human full-length cDNA for CLASP2α, CLASP2-9S/A and CLASP2-8S/D (kind gift from Dr. Torsten Wittman, University of California San Francisco) and these were subcloned into the lentiviral vector pFUW and sequence verified. To generate truncated GFP-CLASP2 variants, we used full-length human CLASP2α as template and designed PCR primers at the regions of lowest complexity in order to optimally preserve domain structure, specifically 1–820, 821–1515, 1–270, 271–573, 574–820, 821–1200 and 1200–1515 amino acids were amplified by PCR and subcloned into pEGFP-C3 (Invitrogen).

Two different shRNA against mouse MFN2 was constructed using Broad Institute software, and cloned into pSICO (Addgene), one beginning at base pair 2009, the other at 3355. A scrambled sequence was also constructed. The lentivirus was then produced by co-transfecting the pSICO vector harboring the siRNA sequence with the following packing, Res and Pol plasmids: pRSV-Rev, pMDLg/pRRE, pMD2.G. Transfection was achieved using polyethylenimine, and the supernatant containing the virus harvested at 48 and 72 h afterwards. The effectiveness of the lentivirus was tested on HEK cells to determine titer.
The virus was injected in to 3-week-old mice via retro-orbital injection. Animals were sacrificed 4 weeks after injection, and the kidneys removed for histological analysis and the cells isolated for experiments.

Lentiviral vector of Sox2 promoter-driven Hsv-TK and matched control were generated as reported previously^{34 (link)}. Lentiviral vector of Bmi1 promoter-driven TK was generated by replacing Sox2 promoter with Bmi1 promoter in the above TK plasmid. Lentiviral vector of Sox2 promoter-driven DTR was generated by replacing TK cDNA with the coding sequence of simian DTR in the plasmid of Sox2 promoter-driven TK. Mouse Rab27a shRNA and scramble shRNA were constructed using the vector pSico (Addgene). Rab27a shRNA-1: GGAGAGGTTTCGTA-GCTTA, Rab27a shRNA-2: GCTTCTGTTCGACCTGACA, scramble shRNA sequence: ATCTCGCTTGGGCGAGAGT. Plasmids of rAAV2-FLEX-rev-ChR2:tdTomato were purchased from Addgene. Lentiviruses were produced by transfecting viral plasmids and packaging plasmids into HEK293T cells, purified via ultra-centrifugation and titrated using p24 ELISA kit as described previously^{32 (link)}.