Biosystems 7300 real time pcr system

Total RNA was extracted from frozen tissues and breast cancer cell lines, using the RNeasy Mini Kit (Qiagen, valencia, CA, USA), and the purity of the preparation was checked by ratio of the absorbance at 260 and 280 nm. The cDNA was synthesized with 2 μg of RNA using QuantiTect Reverse Transcription Kit (Qiagen). The expression of miR-26a/26b was determined by using mirVanaTM qRT-PCR microRNA Detection Kit (Ambion Inc., Austin, TX, USA) and normalized using U6 snRNA and RNU48 as control. ST mRNA was quantified with SYBR Green Quantitative Real-Time PCR Master Mix Kit (Toyobo Co., Osaka, Japan) and normalized to GAPDH and β-action, respectively. The expression level of ST target genes was determined by using Biosystems 7300 Real-Time PCR System (ABI, Foster City, CA, USA). The sequences of primers were as shown in Table 2. Three independent experiments were each performed in triplicate.

Total RNA was isolated from frozen tissues and CRC cell lines, using the RNeasy Mini Kit (QIAGEN, Valencia, CA, USA), and cDNA was synthesized using QuantiTect Reverse Transcription Kit (QIAGEN, valencia, CA, USA) according to the manufacturer’s specifications. The expression of miRNAs was determined by using mirVanaTM qRT-PCR microRNA Detection Kit (Ambion Inc., Austin, TX, USA). Relative quantities of each miRNA were calculated using the ΔΔCt method after normalization with endogenous reference U6-small nuclear RNA. FUT4 mRNA was quantified with SYBR-Green-quantitative real-time PCR Master Mix kit (Toyobo Co., Osaka, Japan). The expression level of FUT4 was determined by using Biosystems 7300 Real-Time PCR system (ABI, Foster City, CA, USA) and calculated using the ΔΔCt method after normalisation with endogenous reference RNA 18 s. All PCR reactions were performed in triplicate for a technical replicate, including no-template controls, and the mean of the triplicates was used.

Total RNA was extracted from tissues and cells with the use of TRIzol reagent (Takara, Dalian, China), followed by measurement of RNA concentration and purity using a NanoDrop spectrophotometer. RNA was reverse-transcribed into cDNA with the kit (TaKaRa, Tokyo, Japan). RT-qPCR was performed on a Biosystems 7300 real time PCR system (ABI, Foster City, CA, USA) according to the instructions of a SYBR GreenMix kit (TaKaRa). Each PCR experiment was performed in triplicate, and a PCR system was added with 10 ng cDNA. Gene expression was analyzed by the 2^−ΔΔCt method (Soejima and Koda 2008 (link)) [ΔΔCt = (Ct _{target gene} − Ct _{housekeeping gene}) _{experimental group} − (Ct _{target gene} − Ct _{housekeeping gene}) _{control group}]. GAPDH and U6 were used as housekeeping genes for NOTCH2 and miR-150-5p, respectively. Each experiment was repeated thrice. Primer design and PCR experiments were carried out by RiboBio (Guangzhou, China) (see in Table 1 for primer sequences).Table 1

Primer sequences

Name of primer	Sequences
miR-150-5p-F	TCTCCCAACCCTTGTA
miR-150-5p-R	GAATACCTCGGACCCTGC-
U6-F	AAAGCAAATCATCGGACGACC
U6-R	GTACAACACATTGTTTCCTCGGA
NOTCH2-F	ATTGTCAAACGGTGTTGGCG
NOTCH2-R	CCCACAGGGCATAAGCAAGA
GAPDH-F	CCGCATCTTCTTGTGCAGTG
GAPDH-R	ACCAGCTTCCCATTCTCAGC

F forward, R reverse