Kapa hifi hotstart

Manufactured by Roche

Sourced in United States

KAPA HiFi HotStart is a high-fidelity DNA polymerase designed for sensitive and challenging PCR applications. It provides reliable and consistent amplification with improved specificity and sensitivity compared to traditional DNA polymerases.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 2, by Thermo Fisher Scientific (4 mentions) Ampure bead, by Beckman Coulter (4 mentions) Nextera kit, by Illumina (4 mentions) E gel, by Thermo Fisher Scientific (2 mentions) Qubit dsdna br assay, by Thermo Fisher Scientific (2 mentions) Kapa library prep kit, by Roche (2 mentions) Nebnext multiplex oligo, by Illumina (2 mentions) Superscript 3, by Thermo Fisher Scientific (2 mentions) Nimblegenseqcap ez system, by Roche (2 mentions) Agencourt rnadvance blood kit, by Beckman Coulter (2 mentions) Neb second strand synthesis kit, by New England Biolabs (2 mentions) Tapestation, by Agilent Technologies (2 mentions) Novaseq, by Illumina (2 mentions) Qubit nucleic acid quantitation, by Thermo Fisher Scientific (2 mentions) Nextera primers, by Illumina (2 mentions) Hiseq 2500, by Illumina (2 mentions) Qpcr library quantification kit, by Roche (2 mentions) Ampure beads, by Roche (2 mentions) Dpni, by New England Biolabs (2 mentions) Nextera xt dna library prep kit, by Illumina (2 mentions)

Spelling variants of this product

KAPA HiFi HotStart Uracil+ ReadyMix (33 citations) KAPA HiFi (30 citations) KAPA HotStart HIFI 2× ReadyMix (17 citations) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (14 citations) KAPA HiFi HotStart Uracil+ DNA polymerase (12 citations) KAPA HiFi HotStart Uracil+ ReadyMix (2X) (6 citations) KAPA HiFi HotStart Real-Time Library Amp Kit (3 citations) KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (3 citations) KAPA HiFi HotStart PCR Ready Mix (2x) (2 citations) Kapa HiFi Uracil Hotstart polymerase enzyme (2 citations)

27 protocols using kapa hifi hotstart

Construction and Characterization of DNMT3A Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length cDNA of human DNMT3A-WT was constructed into the NheI/NotI multiple cloning sites of lentiviral vector pCDH-CMV-MCS-EF1-Puro according to the standard method and verified by sequencing. Point mutants R882C and R882H and deletion mutant Q515X of DNMT3A gene were generated from WT using site-directed mutagenesis (KAPA HiFi HotStart, Kapa Biosystems) and confirmed by full-length DNA sequencing. Wild-type and mutant-DNMT3A with N-terminal 2 × FLAG tagged was then subcloned into pIRES2-EGFP-vector. Lentiviruses production, cell infection, and selection of puromycin-resistant cells were performed as our previous description [18] . The pLKO.1-puro plasmid-based shRNAs, including shLuc (luciferase shRNA, TRCN231719), human PRDX2-sh1 (TRCN0000064906), PRDX2-sh2 (TRCN0000064907), mouse Prdx2-sh1 (TRCN0000120694), Prdx2-sh2 (TRCN0000322525), and human cMYC-sh1 (TRCN0000010389) and cMYC-sh2 (TRCN0000010390), were obtained from the National RNAi Core laboratory, Taiwan. For shRNA-mediated knockdown of PRDX2 or Prdx2, cells were infected with pLKO.1-puro plasmid-based shRNAs lentivector and selected with puromycin.

Bera R., Chiu M.C., Huang Y.J., Liang D.C., Lee Y.S, & Shih L.Y. (2018). Genetic and Epigenetic Perturbations by DNMT3A-R882 Mutants Impaired Apoptosis through Augmentation of PRDX2 in Myeloid Leukemia Cells. Neoplasia (New York, N.Y.), 20(11), 1106-1120.

+ Open protocol

+ Expand

CRISPR-Cas9 Deletion of bnl Coding Exon

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two gRNA target sites were selected within the first coding exon of the bnl using the flyCRISPR Optimal Target Finder tool and were designed following the recommendations ((Gratz et al., 2014 (link)), Figure 2A). All the candidates were evaluated by setting “maximum stringency” and “NGG only” for “PAM”. Two sites with no potential off-targets were selected and sequence verified to ensure no mutations in the genome of the parent fly stocks selected for injection (nos-Cas9 (on X chromosome), BL# 54591). Also, the potentially “good” activities of both gRNAs were predicted using the software tool described in (Doench et al., 2014 (link)). Two gRNAs that matched all those criteria (PAM sequence underlined) were:
gRNA1: TGTATCTGCGATGCCCCTCATGG gRNA2:
ATCCTTCAGATATTGCGGGATGG
These gRNAs were expected to delete a 835 nucleotide (nt) region of the coding exon. The gRNAs were cloned using Gibson Assembly (NEB) of the PCR products (amplified with primers listed in Table 2) into a pCFD4 RNA expression vector following a gRNA cloning protocol (Port et al., 2014 (link)). All PCR reactions were carried out either with KAPA HiFi Hot Start- (Kapa Biosystems) or Q5 Hot Start High Fidelity- (NEB) DNA polymerase following the manufacturers' protocol. For gel purification or clean-up of the PCR products, purification kits from Zymo Research were used.

Du L., Zhou A., Patel A., Rao M., Anderson K, & Roy S. (2017). Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental biology, 427(1), 35-48.

+ Open protocol

+ Expand

Size Selection and Amplification for PacBio Library

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were subsequently size-selected using E-gel (Invitrogen) to obtain 3 different ranges: 1000–1500 bp, 1500–2500 bp and >2500 bp. Two shorter fractions of 200–500 bp, 500–1000 bp were collected, but following preliminary sequencing data, it was decided not to scale them up, due to the large number of reads in this size range obtained in the larger fractions. Following size selection, each size fraction was dried and resuspended with 20 µl of water and quantified by Qubit® dsDNA BR assays (ThermoFisher). These samples were then amplified again by PCR (4 cycles) using Kapa HiFi HotStart (kapaBiosystems) in order to reach the required amount for PacBio library preparation. The quality and the length of obtained libraries was verified using Bioanalyzer and Qubit.
The efficiency of size selection was also checked by analysis of spike-in sequences (Supplementary Figure 1d). For each size-selected captured library, and for pre-capture libraries, the sequencing efficiency was calculated as a function of spike-in sequence length. Sequencing efficiency was defined for each spike-in sequence as: (Number of reads) / (molar concentration * sequence length * total read count). This showed that, as expected, size-selection boosted the sequencing of longer templates.

Lagarde J., Uszczynska-Ratajczak B., Carbonell S., Pérez-Lluch S., Abad A., Davis C., Gingeras T.R., Frankish A., Harrow J., Guigo R, & Johnson R. (2017). High-throughput annotation of full-length long noncoding RNAs with Capture Long-Read Sequencing. Nature genetics, 49(12), 1731-1740.

+ Open protocol

+ Expand

Size Selection and Amplification for PacBio Library

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Evaluation of DNA Polymerases for Preamplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following 12 DNA polymerases were evaluated in preamplification: KAPA HiFi HotStart (KAPA Biosystems), SeqAmp (Clontech), Terra direct (Clontech), Platinum SuperFi (Thermo Fisher), Precisor (Biocat), Advantage2 (Clontech), AccuPrime Taq (Invitrogen), Phusion Flash (Thermo Fisher), AccuStart (QuantaBio), PicoMaxx (Agilent), FideliTaq (Affymetrix), and Q5 (New England Biolabs). For each enzyme, at least three replicates of 1 ng UHRR were reverse transcribed using the optimized molecular crowding reverse transcription in 10 µl reactions. Optimal concentrations for dNTPs, reaction buffer, stabilizers, and enzyme were determined using the manufacturer’s recommendations. For all amplification reactions, we used the original SCRB-seq PCR cycling conditions⁸.

Bagnoli J.W., Ziegenhain C., Janjic A., Wange L.E., Vieth B., Parekh S., Geuder J., Hellmann I, & Enard W. (2018). Sensitive and powerful single-cell RNA sequencing using mcSCRB-seq. Nature Communications, 9, 2937.

+ Open protocol

+ Expand

Plasma RNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from 200 μl plasma using the Agencourt RNAdvance blood kit (Beckman Coulter) eluted into 11 μl of water and then reverse transcribed using Superscript III (Invitrogen) with random hexamers and a NEB Second Strand Synthesis kit (New England BioLabs) for library preparation using the KAPA Library Prep kit (KAPA Biosystems) with index tagging by 16 cycles of PCR using KAPA HiFi HotStart (KAPA Biosystems) and NEBNext Multiplex Oligos (oligonucleotides) for Illumina Index Primer Sets 1 and 2 (New England BioLabs). Libraries were quantified by Qubit (ThermoFisher) and TapeStation (Agilent) and pooled at equimolar concentrations for sequencing on the Illumina MiSeq platform (v3 chemistry).
For capture, pooled G_meta libraries were enriched by either the NimbleGen SeqCap EZ system (Roche) (G_Nimb) or the SureSelect Target Enrichment system (Agilent) (G_SSel), the latter with double-scale reactions and hybridization for 36 h rather than the recommended 16 to 24 h, and then sequenced on the Illumina MiSeq platform using v3 chemistry (Illumina).

Thomson E., Ip C.L., Badhan A., Christiansen M.T., Adamson W., Ansari M.A., Bibby D., Breuer J., Brown A., Bowden R., Bryant J., Bonsall D., Da Silva Filipe A., Hinds C., Hudson E., Klenerman P., Lythgow K., Mbisa J.L., McLauchlan J., Myers R., Piazza P., Roy S., Trebes A., Sreenu V.B., Witteveldt J., Barnes E, & Simmonds P. (2016). Comparison of Next-Generation Sequencing Technologies for Comprehensive Assessment of Full-Length Hepatitis C Viral Genomes. Journal of Clinical Microbiology, 54(10), 2470-2484.

+ Open protocol

+ Expand

Nucleic Acid Target and crRNA Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

For generation of nucleic acid targets, oligonucleotides were PCR amplified with KAPA Hifi Hot Start (Kapa Biosystems). dsDNA amplicons were gel extracted and purified using a MinElute gel extraction kit (Qiagen). The resulting purified dsDNA was transcribed via overnight incubation at 30°C with the HiScribe T7 Quick High Yield RNA Synthesis kit (New England Biolabs). Transcribed RNA was purified using the MEGAclear Transcription Clean-up kit (Thermo Fisher). All RNA targets used in this study are listed in Supplementary Table 4 and 6.
To generate crRNAs, oligonucleotides were ordered as DNA (Integrated DNA Technologies) with an additional 5′ T7 promoter sequence. crRNA template DNA was annealed with a T7 primer (final concentrations 10 uM) and transcribed via overnight incubation at 37°C with the HiScribe T7 Quick High Yield RNA Synthesis kit (New England Biolabs). The resulting transcribed crRNAs were purified with RNAXP clean beads (Beckman Coulter), using a 2× ratio of beads to reaction volume, supplemented with additional 1.8× ratio of isopropanol (Sigma). crRNA constructs used for in vitro experiments study are listed in Supplementary Table 5 and crRNA constructs used for collateral detection are listed in Supplementary Table 6.

Abudayyeh O.O., Gootenberg J.S., Essletzbichler P., Han S., Joung J., Belanto J.J., Verdine V., Cox D.B., Kellner M.J., Regev A., Lander E.S., Voytas D.F., Ting A.Y, & Zhang F. (2017). RNA targeting with CRISPR-Cas13a. Nature, 550(7675), 280-284.

+ Open protocol

+ Expand

16S rRNA Gene Sequencing of Mouse and Human Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was amplified using Kapa-HiFi Hotstart (KK2502, Kapa Biosystems) using primers to 16S-V4 regions (V4-515F - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA, V4-806R - GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT) on a BioRad CFX 384 real-time PCR instrument with four serial 10-fold dilutions of extracted DNA template. Individual sample dilutions in the exponential phase were selected using an OpenTrons OT2 for subsequent indexing PCR using a dual GoLay error-correcting index primers (37 (link)). DNA concentration was measured using a PicoGreen assay (P7589, Life Technologies, South San Francisco, CA, USA), and samples were pooled at equimolar concentrations. Agencourt AMPure XP magnetic beads were used to purify the pooled PCR product, and the samples were subsequently sequencing on an Illumina MiSeq using 15% PhiX spiked in for sequencing. Mouse samples were amplified using V4 primers as previously described (38 (link)). All sequencing was paired, with human 16S as 270 bp and mouse 16S as 150 bp fragments. Amplicon reactions were pooled at equimolar concentrations and purified using the Agencourt AMPure XP magnetic beads. The pooled library was loaded onto the Illumina NextSeq 550 platform using 40% PhiX spiked in for sequencing.

Upadhyay V., Suryawanshi R.K., Tasoff P., McCavitt-Malvido M., Kumar R.G., Murray V.W., Noecker C., Bisanz J.E., Hswen Y., Ha C.W., Sreekumar B., Chen I.P., Lynch S.V., Ott M., Lee S, & Turnbaugh P.J. (2023). Mild SARS-CoV-2 infection results in long-lasting microbiota instability. mBio, 14(4), e00889-23.

+ Open protocol

+ Expand

Inducible mCherry Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

231-caPep cells were seeded in a 60-mm plate at 5 × 10⁵ cells per sample and allowed to attach for 5 h. Dox was added to induce sample at a final concentration of 1 μg/ml. Cells were incubated overnight at 37 °C and 5 % CO₂. The next morning, RNA was prepared using standard protocol for purifying total RNA from animal cells provided with RNeasy Mini kit (Qiagen, 74104). QIAshredder columns (Qiagen, 79654) were used for the homogenization step. Genomic DNA elimination and cDNA synthesis were performed using RT² Easy First Strand kit (Qiagen, 330401). The amplification reactions were performed in MJ Mini Thermocycler (Bio-Rad, PTC-1148C) using KAPA HiFi Hotstart (KAPA Biosystems, KK2501). Reaction condition #1 used primers that annealed to the 5′ (5′GTGAGCAAGGGCGAGG AGG-3′) and 3′ (5′GTTCCACGATGGTGTAGTCC-3′) ends of the mcherry sequence in the cDNA template. Reaction condition #2 used primers that annealed to the 5′ end of caPeptide (5′GCGTGCTGCCTGGGCATCC-3′) and the same downstream primer as in reaction #1. Thirty cycles of PCR were performed. Samples were electrophoresed on a 1 % agarose gel and stained with ethidium bromide.

Lingeman R.G., Hickey R.J, & Malkas L.H. (2014). Expression of a novel peptide derived from PCNA damages DNA and reverses cisplatin resistance. Cancer chemotherapy and pharmacology, 74(5), 981-993.

+ Open protocol

+ Expand

Engineered Constructs for Hematopoiesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length cDNA of human RUNX1-WT with FLAG-tag was constructed into the NheI/NotI multiple cloning sites of lentiviral vector pCDH1-MSCV-MCS-EF1-Puro (pCMSCV, EV2) according to the standard method and verified by sequencing. Point mutant, R135T of RUNX1 gene, was generated from FLAG-RUNX1-WT using site-directed mutagenesis (KAPA HiFi HotStart, Kapa Biosystems) and confirmed by full-length DNA sequencing. ASXL1-R693X tagged with a FLAG epitope at the N-terminus was subcloned into pIRES2-EGFP-vector, then either empty vector or FLAG-ASXL1-R693X-IRES2-EGFP cassette was inserted into the pCMSCV vector to make pCMSCV-IRES2-EGFP (EV1) or pCMSCV-FLAG-ASXL1-R693X-IRES2-EGFP plasmid. Similarly, RUNX1-R135T and ASXL1-R693X were constructed into the BglII/HpaI multiple cloning sites of retroviral vector pMSCVhyg and pMSCVneo plasmids respectively. All sequences were confirmed by direct sequencing before expression in cells. The pLKO.1-puro plasmid-based shRNAs, including shLuc (luciferase shRNA, TRCN231719), human ID1-sh1 (TRCN0000019029), and ID1-sh2 (TRCN0000019030), were obtained from the National RNAi Core laboratory, Taiwan.

Bera R., Chiu M.C., Huang Y.J., Lin T.H., Kuo M.C, & Shih L.Y. (2019). RUNX1 mutations promote leukemogenesis of myeloid malignancies in ASXL1-mutated leukemia. Journal of Hematology & Oncology, 12, 104.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!