High performance liquid chromatography (hplc)

Cholesterol-tagged DNA (sequence: 5ʹ (Cy3)-ACCAGACAATACCACACAATTTT-CholTEG 3ʹ, HPLC purified) and the Cy-5 labeled triplex-forming DNA (sequence: 5ʹ Cy5-TTCTCTTCTCGTTTGCTCTTCTCTTGTGTGGTATTGTCTAAGAGAAGAG 3ʹ, adapted from Green et al.^{36 (link)}, HPLC purified) were purchased from Biomers or Integrated DNA Technologies. Both DNA sequences were encapsulated in microfluidic droplets at a concentration of 1.5 μM and 1 μM, respectively. For the calibration measurement (Fig. 3b), the aqueous solution inside the droplets additionally contained 50 mM potassium phosphate buffer at the respective pH. Propylamine (from Sigma Aldrich) and Trifluoracetic Acid (TFA, from Sigma Aldrich) were flushed to dynamically change the pH of the droplets’ aqueous phase. For the co-encapsulation of the DNA together with the E. coli (OD₆₀₀ ≈ 20), a two-inlet droplet formation device was used (see Supplementary Fig. 7). Droplets were sealed in an observation chamber for confocal fluorescence imaging experiments.