The largest database of trusted experimental protocols

10 protocols using power sybrs green pcr master mix

1

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using Trizol (Invitrogen, USA). High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) was used for cDNA synthesis. qRT-PCR amplification reactions were performed using Power SYBRs Green PCR Master Mix (Applied Biosystems, USA) and ABI 7900 real-time PCR system (Applied Biosystems, USA). GAPDH was set as the internal reference gene. Relative expression of genes was calculated using 2−ΔΔCt method. Primers for qRT-PCR were listed as follows: CBFB-F: 5′-AGAAGCAAGTTCGAGAACGAG-3′; CBFB-R: 5′-CCTGAAGCCCGTGTACTTAATCT-3′. ACAT1-F: 5′-AAGGCAGGCAGTATTGGGTG-3′; ACAT1-R: 5′-ACATCAGTTAGCCCGTCTTTTAC-3′. OXSM-F: 5′-TGATGCTGGTCACATAACTGC-3′; OXSM-R: 5′-TCCCAATGGTGTGGAAGTAGC-3′. VAPA-F: 5′-AGATCCTGGTCCTCGATCCG-3′; VAPA-R: 5′-TTTTCTATCCGATGGATTTCGCA-3′. GAPDH-F: 5′-GGAGCGAGATCCCTCCAAAAT-3′; GAPDH-R: 5′-GGCTGTTGTCATACTTCTCATGG-3′.
+ Open protocol
+ Expand
2

Real-time RT-PCR and ChIP Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For real-time reverse transcriptase–PCR35 (link), total RNA was isolated using an RNeasy kit (Qiagen). cDNA was reverse transcribed from total RNA (2 μg) using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Real-time PCR analysis was performed using Power SYBRs Green PCR Master Mix (Applied Biosystems) on the StepOnePlusTM Real-Time PCR System (Applied Biosystems) following the manufacturer's instructions. For ChIP assay35 (link), chromatin was cross-linked for 10 min at room temperature with 1% formaldehyde. The chromatin was immunoprecipitated with 4 μg of antibodies at 4 °C overnight. The reverse cross-linked ChIP DNA was purified and then analysed by real-time PCR. The primers are listed in Supplementary Table 2.
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of TUG1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and cDNAs were synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). qRT-PCRs were conducted using the Power SYBRs Green PCR Master Mix (Applied Biosystems) on the StepOne Plus Real-Time PCR System. The PCR profile was 94 °C for 10 min, and 42 cycles of 94 °C for 10 s and 58 °C for 15 s. GAPDH was used as internal control. The PCR products were verified by melting curve analysis as well as by 2.0% agarose gel electrophoresis. Data analysis was performed using the 2−△△Ct method. The primer sequence was shown below: Forward sequence for mouse TUG1: 5′-GAGACACGACTCACCAAGCA-3′ Reverse sequence for mouse TUG1: 5′-GAAGGTCATTGGCAGGTCCA-3′ Forward sequence for human TUG1: 5′-ACGACTGAGCAAGCACTACC-3′ Reverse sequence for human TUG1: 5′-CTCAGCAATCAGGAGGCACA-3′.
+ Open protocol
+ Expand
4

Real-time RT-PCR and ChIP Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For real-time RT-PCR35 (link), total
RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA). cDNA was reverse transcribed
from total RNA (2 µg) using a High Capacity cDNA Reverse Transcription Kit
(Applied Biosystems, Foster City, CA). Real-time polymerase chain reaction was performed
using Power SYBRs Green PCR Master Mix (Applied Biosystems) on the StepOnePlusTM Real-Time
PCR System (Applied Biosystems) following the manufacturer’s instructions. For
ChIP assay35 (link), chromatin was crosslinked
for 10 min at room temperature with 1% formaldehyde. The chromatin was
immunoprecipitated with 4 µg of antibodies at 4°C overnight. The reverse
crosslinked ChIP DNA was purified and then analyzed by real-time PCR. The primers are
listed in Supplementary Table
2
.
+ Open protocol
+ Expand
5

Quantifying OSCC Cell RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of OSCC cells was extracted by applying a Trizol reagent following the instructions. Utilizing a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, UK), cDNA was synthesized. Then qPCR was executed on a ABI7300 real-time PCR machine (Helsinki, Finland) utilizing Power SYBRs Green PCR Master Mix (Applied Biosystems) by employing GAPDH as an endogenous control. The relative expression level was calculated utilizing the 2-ΔΔCt method. Table 1 illustrated the primes utilized in qRT-PCR.

The primers utilized in qRT-PCR

NameSequences
E2F7 forward5′-TCTGAACCCGACTGTCCCTCTT-3’
E2F7 reverse5′-TTTGGCAGCCACATCCAGAGTG-3’
GAPDH forward5′-TGTGTCCGTCGTGGATCTGA-3’
GAPDH reverse5′-CCTGCTTCACCACCTTCTTGA-3’
+ Open protocol
+ Expand
6

Quantitative gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted using TRIzol reagent (Invitrogen). cDNAs were synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCRs were conducted using the Power SYBRs Green PCR Master Mix (Applied Biosystems) on the StepOne Plus™ Real-Time PCR System. The PCR profile was 94°C for 10 min, and 42 cycles of 94°C for 10 s and 58°C for 15 s. PCR products were verified by melting curve analysis as well as by 2.0% agarose gel electrophoresis. Data analysis was conducted using the 2−ΔΔCt method.
+ Open protocol
+ Expand
7

Quantification of LINC00630, FGF7, and miR-199a

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used for total RNA extraction, following the manufacturer's instructions. Then, 2 μg RNA was used for the reverse transcription of RNA to cDNA using M-MLV reverse transcriptase (Promega Corporation). qPCR was conducted using Power SYBRs Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) to detect the mRNA expression of LINC00630 and FGF7. miR-199a expression was detected using the TaqMan™ MicroRNA Reverse Transcription kit and TaqMan Universal Master Mix II kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). GAPDH and U6 were used as the endogenous reference for mRNA and miRNA, respectively. All forward and reverse primers were obtained from Biomics. The primer sequences used were as follows: LINC00630, 5'-TACCGTTATTATTTCCC-3' forward and 5'-TCCTAAGTATTGACCCT-3' reverse; FGF7, 5'-AATGACATGAGTCCGGAGCAA-3' forward and 5'-CCATAGGAAGAAAATGGGCTG-3' reverse; GAPDH, 5'-AGGTGAAGGTCGGAGTCAACG-3' forward and 5'-AGGGGTCATTGATGGCAACA-3' reverse; miR-199a, 5'-CGCGCCCAGTGTTCAGACTAC-3' forward and 5'-AGTGCAGGGTCCGAGGTATT-3' reverse; U6, 5'-CTCGCTTCGGCAGCACA-3' forward and 5'-AACGCTTCACGAATTTGCGT-3' reverse. The expression of miRNA and mRNA was expressed as a fold change using the 2-∆∆Cq method 9 (link).
+ Open protocol
+ Expand
8

Examining MALAT1, Wnt, and Apoptosis Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Trizol reagent (Invitrogen) was used to extract total RNA following kit specifications. Meanwhile, 2 μg RNA was collected to prepare cDNA through reverse transcription via M-MLV (Promega, Madison, WI, USA). Thereafter, qRT-PCR assays via Power SYBRs Green PCR Master Mix (Applied Biosystems, CA, USA) were performed for detecting the expression levels of MALAT1, β-catenin, caspase-3, TCF4, and p300. The miR-1297 expression with Taqman Universal Master Mix II kit and Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems) was tested. U6 and GAPDH served as endogenous references of miRNA and mRNA. The sense/anti-sense chain primers based on Biomics were acquired. Table 1 shows the primer sequences. miR-1297 and mRNAs gene expression was denoted as fold changes using 2−ΔΔCT method [27 (link)].

Primer sequences for different genes

GenesPrimersSequences (5’-3’)
MALAT1ForwardTGGGGGAGTTTCGTACTGAG
ReverseTCTCCAGGACTTGGCAGTCT
β-cateninForwardAAAGCGGCTGTTAGTCACTGG
ReverseCGAGTCATTGCATACTGTCCAT
TCF4ForwardCCTGGCTATGCAGGAATGTT
ReverseCAGGAGGCGTACAGGAAGAG
p300ForwardCTTCCCCACTGTCGCACAAT
ReverseTTTGTCGAGAAGATGCACAGTGT
Caspase-3ForwardTTTGTTTGTGTGCTTCTGAGCC
ReverseATTCTGTTGCCACCTTTCGG
GAPDHForwardCATGTTCCAATATGATTCCACC
ReverseGATGGGATTTCCATTGATGAC
miR-1297ForwardTCGGCAGGTTCAAGTAATT
ReverseCTCAACTGGTGTCGTGGA
U6ForwardATTGGAACGATACAGAGAAGATT
ReverseGGAACGCTTCACGAATTTG
+ Open protocol
+ Expand
9

Quantifying Gene and miRNA Expression in C28/I2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Trizol reagent (Invitrogen) was used for extraction of total RNA from C28/I2 cells under the guideline of the kit instructions. Specifically, RNA (2 μg) was reverse transcribed to cDNA using M-MLV (Promega, Madison, WI, USA). Quantitative PCR assays were conducted on Power SYBRs Green PCR Master Mix (Applied Biosystems, CA, USA) to detect the expression of HOTAIR, BBC3, and caspase-3. The expression of miR-221 was detected using the Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix II kit (Applied Biosystems). GAPDH and U6 were used as the endogenous reference for mRNA and miRNA, respectively. All the primers for the sense and anti-sense chains were obtained from Biomics. The primer sequences are listed as follows: HOTAIR forward: 5’-TAGGCAAATGTCAGAGGGTT-3’, reverse: 5’-ACACAAGTAGCAGGGAAAGG-3’; BBC3 forward: 5’-TTGTGCTGGTGCCCGTTCCA-3’, reverse: 5’-AGGCTAGTGGTCACGTTTGGCT-3’; caspase-3 forward: 5’-TTTGTTTGTGTGCTTCTGAGCC-3’, reverse: 5’-ATTCTGTTGCCACCTTTCGG-3’; GAPDH forward: 5’-AGGTGAAGGTCGGAGTCAACG-3’, reverse: 5’-AGGGGTCATTGATGGCAACA-3’; miR-221 forward: 5’-GGGAAGCTACATTGTCTGC-3’, reverse: 5’-CAGTGCGTGTCGTGGAGT-3’; U6 forward: 5’-CTCGCTTCGGCAGCACA-3’, reverse: 5’-AACGCTTCACGAATTTGCGT-3’. The gene expression of miRNA and mRNA was indicated as fold changes by employing 2−ΔΔCT method [17 (link)].
+ Open protocol
+ Expand
10

Gene Expression Analysis by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using TRIzol (Invitrogen). High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA) was used for cDNA synthesis according to the protocol. RT-qPCR was performed using Power SYBRs Green PCR Master Mix (Applied Biosystems) with β-actin as the endogenous control. The relative expression of TFDP1, AHCY, KCMF1 and MANBAL was calculated using 2−ΔΔCt formula. The primer sequences for RT-qPCR were shown as follows:
β-actin-forward (F): 5ʹ-TTGCTGACAGGATGCAGAAGGAGA-3ʹ; β-actin-reverse (R), 5ʹ-ACTCCTGCTTGCTGA TCCACATCT-3ʹ.
TFDP1-F: 5ʹ-AATTGAAGCCAACGGAGAACTC-3ʹ; TFDP1-R: 5ʹ-CGGTCTCTGAGGCGTACCA-3ʹ.
AHCY-F: 5ʹ-ATTCCGGTGTATGCCTGGAAG-3ʹ; AHCY-R: 5ʹ-GAGATGCCTCGGATGCCT-3ʹ.
KCMF1-F: 5ʹ-TCGAGGTCGCAGATATAAGTGT-3ʹ; KCMF1-R: 5ʹ- CCGTATAGCCCATTTTTCCACAA-3ʹ.
MANBAL-F: 5ʹ-TGACCTAGACTTCTCACCTCCG-3ʹ; MANBAL-R: 5ʹ-CAGGAAGAGTCCGTACCGTAG-3ʹ.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!