Endo porter reagent

The sequence of the initiation factor eIF4E-1a was found by our lab previously [22 (link)]. Morpholino antisense oligonucleotides (MOs) are nucleic acid analogues in which DNA bases are bound to a non-charged backbone (morpholine rings linked by phosphorodiamidate bonds) [51 (link)]. For our purposes, a translation-blocking MO was created that covered the eIF4E-1a translational start site (5′-TCATTGAAGCTCAAACAAGCCATTG-3′). Specificity for the intended target sites was verified by BLAST analysis against the Amphidinium carterae transcriptome. MOs were purchased from GeneTools (Philomath, OR, USA) and modified with a red-emitting fluorescent 3′ Lissamine addition and then used at a concentration of 1 μM and 10 μM. Standard control MOs with the Lissamine addition were ordered as well (5’-CCTCTTACCTCAGTTACAATTTATA-3’).
MOs were delivered using Endo-Porter reagent (GeneTools, Philomath, OR, USA) at a concentration of 4 µM. Cultures of A. carterae seeded in 12-well plates were treated with either Endo-Porter, MO, or both. Three biological replicates of each treatment were performed.

To downregulate VEGFR1 or VEGFR2, morpholino antisense ASOs specific for VEGFR1 or VEGFR2 (GeneTools, Philomath, OR) were used. The sequences of the ASOs were as follows: VEGFR1, 5′-AAGCCAGGGCCGAGCCGCACATAAT-3′; VEGFR2, 5′-GCAGCACCTTGCTCTGCATCCTGCA-3′. A standard control morpholino oligonucleotide (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as a negative control. Delivery of the oligonucleotides into the cells was performed according to the GeneTools protocol. Briefly, 80–100% confluent SK-MEL-28 cells were treated with 10 μM of the morpholino ASOs or the standard control oligonucleotide and 6 μM of Endo-Porter reagent (GeneTools). After 24 h, the cells were used in the subsequent experiments.

Three antisense morpholino oligos (MOs) used in this study were purchased from Gene Tools (Oregon, USA). MO88 (TTACGGATTGCGCTGCGCCCATTTT) targets orf088. MO72 (GTACAAGTCATTGTTGCTGTTTTTT) targets orf072 encoding the SGIV major capsid protein6 (link). MOctr (CCTCTTACCTCAGTTACAATTTATA) is a general control morpholino oligo that has no target gene in HX1 and SGIV. Briefly, HX1 cells at 70% confluence in 6-well plates were transfected with 10 μM of MOctr, MO72 or MO88 by using the Endo-Porter reagent (Gene Tools, Oregon, USA). At 24 h post transfection, cells were inoculated with SGIV at MOI of 0.1 and virus titers were determined at 72 hpi.