Gel purification kit

BstBI and NdeI digested pTA1392 was gel purified using gel purification kit (MACHEREY-NAGEL, Germany). Oligonucleotides O247 (Sense, p.synF- CGAGAATCGAAACGCTTATAAGTGCCCCCCGGCTAGAGAGAT) and O508 (Antisense, p.synR2-TAATCTCTCTAGCCGGGGGGCACTTATAAGCGTTTCGATTCT) were hybridised to generate the p.syn promoter DNA with ClaI and NdeI-compatible ends. Oligo hybridisation was performed in an Eppendorf tube containing 20 μl of each oligo (10 μM), 10 μl of NEB Buffer 2 and 50 μl dH₂O at boiling temperature and cooling afterwards. BstBI and NdeI digested pTA1392 and hybridised oligos were ligated and transformed into E.coli XL-1 Blue by electroporation. Following plasmid extraction (Maxiprep, MACHEREY-NAGEL, Germany) integration of p.syn promoter was verified using two sequencing primers (O363: TTAAGTTGGGTAACGCCAGGG) and (O919: AATTCGATATCTCACTTCTCGAACTGCGGGTGCGACCAGCTAGCTGGGGCGCCA). The resulting plasmid was designated pTA1992.

The coding sequences of mouse Cry1 and firefly Luciferase (Luc) (in pG5Luc plasmid, Addgene, Watertown, USA) were amplified by using primers with EcoRV-NotI flanking sites for Crys and NotI-XhoI flanking sites for Luc (Table S1). Then, Cry1-Luc, Cry2-Luc and Luc genes were subcloned into the pcDNA4A-myc-his plasmid. After verifying the size of the product in agarose gel, NucleoSpin PCR and Gel purification kits (Macherey Nagel, Düren, Germany) were used to isolate the product from agarose gel. pcDNA4A plasmid with Luc (insert) and Cry1 or Cry2 pcDNA4A-myc-his (host) were digested by using NotI and XhoI enzymes (FastDigest, Thermo Scientific, Waltham, USA). To inhibit self-annealing, FASTAP enzyme (Thermo Scientific, Waltham, USA) was added to host plasmids. Inserts were isolated from the gel and then cleaned up by Gel purification kit (Macherey Nagel, Düren, Germany). Finally, T4 DNA ligase (Thermo Scientific, Waltham, USA) was used to ligate the insert and host.

The Clone Manager Suite (Sci-ED Software) was used for primer design. If required for cloning, overhangs were fused to the primers adding, for example, restriction sites to the sequence. All oligonucleotides were synthesized by MWG Eurofins. The polymerase chain reaction (PCR) was performed in a Biometra TGradient cycler using standard protocols. The optimal annealing temperatures were determined by temperature screening. All PCR products were extracted from agarose gels (Gel purification kit, Macherey-Nagel). DNA was sequenced by GATC Biotech.

RNA from organoids was reverse transcribed with the SensiFAST™ cDNA Synthesis Kit (Bioline) and cDNA was amplified with Phusion High Fidelity DNA Polymerase (Thermo Fisher), using the following primers: TP53: TGAAGCTCCCAGAATGCCAG and CTTCAGGTGGCTGGAGTGAG (65 °C), TP53 (DNA binding domain): CCCTGCCCTCAACAAGATGT and CTCAAAGCTGTTCCGTCCCA; KRAS: CCCAGGTGCGGGAGAGA and AACAGTCTGCATGGAGCAGG (65 °C). PCR products were then isolated from 2% gel, purified by the Gel Purification Kit (Macherey–Nagel) and sequenced by the forward primers with an Applied Biosystems 3500 Genetic Analyzer instrument (Life Technologies). Results were analyzed by Chromas 2.6 software (Technelysium Pty Ltd).