7500 system sds software version 1

Total RNA from dorsal skin tissues and cells was isolated using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). Complementary DNA synthesis was performed using an iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). PCR amplification consisted of 40 cycles of 95 °C for 15 s, 58 °C for 15 s, and 72 °C for 30 s with SYBR Green PCR Master Mix (Bio-Rad) and primer pairs (Table 1). The data analysis was performed using 7500 System SDS software version 1.3.1 (Applied Biosystems, Foster City, CA, USA).

RBL-2H3 cells were treated with DMSO or maltol derivatives (10 μM) for 30 min before inflammation was induced with PMA/ionomycin (PI), which induced a state similar to AD. After 16 h of PI treatment, cells were harvested to measure IL-4 mRNA levels by quantitative real-time PCR (Q-PCR). Briefly, total RNA was isolated from the RBL-2H3 cells using RNAiso Reagent (TaKaRa, Shiga, Japan), according to the manufacturer's instructions. The following primer sequence was used: IL-4 forward: 5′-ACC TTG CTG TCA CCC TGT TC-3′; IL-4 reverse: 5′-TTG TGA GCG TGG ACTCAT TC-3′; β-actin forward: 5′-TCA TCA CCA TCG GCA ACG-3′, β-actin reverse: 5′-TTC CT GAT GTC CAC GTC GC-3′. Data analyses were performed using 7500 System SDS software version 1.3.1 (Applied Biosystems).

IFN-β mRNA levels induced by rNS1-wt and rNS1-SD30 viruses in infected CEFs were measured by qRT-PCR using SYBR green-based detection with an ABI PRISM 7500 cycler (Applied Biosystems, Foster City, CA, USA). CEF monolayers inoculated with the two rH5N1 variants for 12, 24, and 36 h were washed with ice-cold PBS and then lysed with TRIzol reagent (Invitrogen, USA). Total cellular RNA was extracted using the RNeasy Mini Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. RNA concentrations were measured with a spectrophotometer (OD260/OD280). After DNA inactivation, 2 μg of RNA was reversely transcribed in a 20 μL reaction mixture containing 2 μL avian myeloblastosis virus (AMV) buffer, 50 pM Oligo18T, 0.5 mM dNTPs, 10 U RNase inhibitor, and 20 U AMV reverse transcriptase (TAKARA, Japan). After initial denaturation at 95°C for 30 s, amplification was carried out through 40 cycles, each consisting of denaturation at 95°C for 15 s, primer annealing at 60°C for 30 s, and DNA extension at 72°C for 45 s. Melting curves were obtained, and quantitative analysis of the data was performed using the 7500 System SDS software Version 1.3.1 using a relative quantification (ddCt) study model (Applied Biosystems). Primers for chicken IFN-β mRNA and the internal standard 18S rRNA were used as previously reported [16 (link)].

The liver tissue was homogenized with rotor-stator homogenizers in the presence of buffer RLT (lysis buffer; Qiagen, Valencia, CA, USA) including 1% β-mercaptoethanol. Total RNA was extracted from liver tissue lysate using the RNeasy Mini kit (Qiagen). Complementary DNA was synthesized from 1 µL purified total RNA in 20 µL of reaction buffer using the iScript™ cDNA synthesis kit (Bio-Rad Laboratories). Real-time polymerase chain reaction (PCR) (Applied Biosystems, Foster City, CA, USA) was performed on triplicate samples using 1 µL cDNA with the SYBR Green PCR Master Mix (iQ SYBR Green Supermix, Bio-Rad Laboratories). The cDNA was amplified for 40 cycles of denaturation (95°C for 30 s), annealing (58°C for 30 s) and extension (72°C for 45 s) with specific primers (Table 1). The real-time RT-PCR results were visualized and the relative quantitation was calculated using the 7500 System SDS software version 1.3.1 (Applied Biosystems).

Serum-deprived confluent HASM cell cultures were stimulated for the specified time, harvested, and total cellular RNA was extracted using TRIzol method (Invitrogen Canada Inc., Burlington, ON). Reverse transcription was performed by using 2 μg of total RNA in a first-strand cDNA synthesis reaction with High Capacity cDNA Reverse transcriptase kit as recommended by the supplier (Applied Biosystems, Foster City, CA, USA. Primers for human housekeeping gene, glyceraldhyde-3-phosphate dehydrogenase (GAPDH) are forward primer 5′-AGCAATGCCTCCTGCACCACCAAC-3′ and reverse primer 5′-CCGGAGGGGCCATCCACAGTCT-3′. Primers for smMLCK are forward Primer: 5′ GACTGCAAGATTGAAGGATAC 3′ and Reverse Primer: 5′ GTTTCCACAATGAGCTCTGC 3′. Real-time quantitative PCR was carried out using ABI 7500 Real-Time PCR System and analyzed by 7500 System SDS software version 1.3.1 (Applied Biosystems, Foster City, CA, USA), following manufacturer’s instructions. Product specificity was determined by melting curve analysis and by visualization of PCR products on agarose gels. Calculation of the relative amount of each cDNA species was performed according to standard protocols. Briefly, the amplification of smMLCK gene in stimulated cells was calculated first as the copy number ratio of smMLCK to GAPDH, and then expressed as normalized values of fold increase over the value obtained with unstimulated (control) cells.