P3xflag cmv 7.1 expression vector

Manufactured by Merck Group

Sourced in Cameroon

The P3XFLAG-CMV-7.1 expression vector is a plasmid designed for the expression of recombinant proteins in mammalian cell lines. It contains a CMV promoter for high-level expression and a 3xFLAG tag sequence for the detection and purification of the expressed protein.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000 transfection, by Thermo Fisher Scientific (1 mentions) Opti mem, by Thermo Fisher Scientific (1 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions) Chemidoc xrs imaging system, by Bio-Rad (1 mentions) Mini protean tgx, by Bio-Rad (1 mentions) Opti mem medium, by Thermo Fisher Scientific (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) 24 well plate, by Corning (1 mentions) Genetailor site directed mutagenesis system, by Thermo Fisher Scientific (1 mentions) Pcdna3.1 mycbioid plasmid, by Addgene (1 mentions) Phusion site directed mutagenesis kit, by Thermo Fisher Scientific (1 mentions) Quikchange kit, by Agilent Technologies (1 mentions) Pfu ultra polymerase, by Agilent Technologies (1 mentions) Pgex 6p 1, by GE Healthcare (1 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions) Fugene, by Promega (1 mentions) Hiperfect, by Qiagen (1 mentions) Mission esirna, by Merck Group (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) One shot top10, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

P3xFLAG-CMV-7.1 vector P3xFLAG-CMV vector P3xFLAG-CMV-7.1

14 protocols using p3xflag cmv 7.1 expression vector

Cloning and Expression of Syntaxin 10

Check if the same lab product or an alternative is used in the 5 most similar protocols

Syntaxin 10 (GenBank accession number CR457110) cDNA (Eurofins MWG Operon; Huntsville, Alabama) served as a template to clone syntaxin 10. The forward primer (5′- ggggggaattcaatgtctctcgaagacccctttt-3′) contained a 5′ EcoRI site (all caps, underlined), and the reverse primer (5′- gggggGGATCCtcagagagagaatagtaagatgagaa-3′) contained a 3′ BamHI site (all caps, underlined), which were used to subclone syntaxin 10 into the multiple cloning site of the p3XFLAG-CMV 7.1 expression vector (Sigma; St. Louis, MO). Sequence was verified by Eurofins MWG Operon, Huntsville, AL. 100 ng of plasmid DNA was transfected with Lipofectamine 2000 Transfection (Life Technologies, Carlsbad, CA) and Opti-MEM (Life Technologies), according to the manufacturer's protocol. Cells were then infected with Chlamydia as described previously (Scidmore, 2005 (link)).

Lucas A.L., Ouellette S.P., Kabeiseman E.J., Cichos K.H, & Rucks E.A. (2015). The trans-Golgi SNARE syntaxin 10 is required for optimal development of Chlamydia trachomatis. Frontiers in Cellular and Infection Microbiology, 5, 68.

+ Open protocol

+ Expand

Cloning and Expressing Key Regulatory Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was made from HeLa cells by Trizol extraction of RNA followed by reverse transcription. Generated cDNA was then used as a template to amplify SERBP1, TRIM25 and PWP2 using Phusion high fidelity DNA polymerase (New England Biolabs) and primers listed in Supplementary Table S5. SERBP1 and PWP2 were cloned into LEICS-12 N-HIS10/3× Flag vector and TRIM25 was cloned into LEICS-49 C-HIS4/3× Flag by the University of Leicester protein expression laboratory. LARP1 was sub-cloned from pCMV5-LARP1 (NM015315.3) into p3xFlag-CMV™-7.1 expression vector (Sigma-aldrich E4026) (restriction digested using Hind3 and XBA1 followed by gel extraction and ligation, to produce n-terminal Flag-tagged LARP1 purposefully omitting the initiating methionine. The primers used are listed in Supplementary Table S5. p3xFlag-CMV™-7-BAP control expression vector was purchased from Sigma (C7472). For generation of pET-SUMO PABPC1, cDNAs coding for PABPC1 (1–636) were generated using standard PCR using PABPC1 primers listed in Supplementary Table S5. PCR product was subsequently cloned into pET-SUMO vector using the BsaI and NotI restriction sites. All CDS open reading frames were sequenced fully for each construct.

Smith E.M., Benbahouche N.E., Morris K., Wilczynska A., Gillen S., Schmidt T., Meijer H.A., Jukes-Jones R., Cain K., Jones C., Stoneley M., Waldron J.A., Bell C., Fonseca B.D., Blagden S., Willis A.E, & Bushell M. (2020). The mTOR regulated RNA-binding protein LARP1 requires PABPC1 for guided mRNA interaction. Nucleic Acids Research, 49(1), 458-478.

+ Open protocol

+ Expand

Shroom3 Isoform Overexpression in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length BN Shroom3, full-length FHH Shroom3, or ∆G1073S mutant cDNA were cloned into the p3xFLAG-CMV-7.1 expression vector (Sigma) and transfected into human embryonic kidney (HEK) 293 cells using a calcium phosphate transfection method. HEK293 cells were cultured in Dulbecco modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS), 1% L-glutamine, penicillin streptomycin (1×), and sodium pyruvate (1×). At 24 h post-transfection, cells were collected and lysed in lysis buffer (200 mM NaCl, 20 mM Tris, 2 mM EDTA, 1% Triton X-100, and 0.1% SDS) to extract protein. Seven hundred and fifty micrograms of protein was used for immunoprecipitation (IP) against FLAG. IP protein products were separated on 4%–20% Bio-Rad mini-PROTEAN TGX gels and transferred onto PVDF membranes, followed by overnight incubation with primary antibodies against FLAG, ACTB, and ROCK1. Membranes were then incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies and developed with enhanced chemiluminescence reagent (Pierce). Protein bands were visualized using a ChemiDoc XRS+ Imaging System (Bio-Rad). Band intensities were quantified with ImageJ software (National Institutes of Health).

Yeo N.C., O’Meara C.C., Bonomo J.A., Veth K.N., Tomar R., Flister M.J., Drummond I.A., Bowden D.W., Freedman B.I., Lazar J., Link B.A, & Jacob H.J. (2015). Shroom3 contributes to the maintenance of the glomerular filtration barrier integrity. Genome Research, 25(1), 57-65.

+ Open protocol

+ Expand

Cloning and Transfection of ISCU Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full length (883 base pairs; intact 3′UTR; ISCU-FL) or fragment (504 base pairs; 3′UTR deletion; ISCU-3′UTR(−)) of Rattus norvegicus of ISCU was cloned from brain-derived cDNA and inserted into p3XFLAG-CMV™−7.1 expression vector (E7533–20UG, Sigma-Aldrich) between the EcoRI and HindIII sites. Primers (IDT) used to amplify ISCU-FL were 5′-ATGGCGGCGGCTGGAGCGGG-3′ (forward); 5′-TAGAGAAAACCATCGTCTTCCATTT-3′ (reverse). Primers used to amplify ISCU-3′UTR(−) were 5′-ATGGCGGCGGCTGGAGCGGG-3′ (forward); 5′-TCACTGCTTCTCCGGCTCGTC-3′ (reverse). All the constructs were confirmed by DNA sequencing to exclude potential PCR-introduced mutations. Rat PC12 cells (ATCC) were maintained in DMEM supplemented with 10% horse serum, 5% fetal bovine serum, and penicillin/streptomycin. The plasmids alone or accompanied with either miR-210 mimic or miR-210 scramble (Neg. Ctrl.) were transfected into PC12 cells with Lipofectamine 2000 (11668027, Invitrogen) in Opti-MEM medium (31985070, Fisher Scientific) according to the manufacturer’s instructions. Medium was refreshed at 5–6 h after transfection to reduce the toxicity. PC12 cells cultured on PDL-coated 6-well plate were collected for western blot assay, or on PDL-coated German 12 mm glass coverslips (Fisher scientific) in 24-well plates (Corning) for immunocytochemistry staining. All the experiments were carried out 48 h after transfection.

Ma Q., Dasgupta C., Li Y., Huang L, & Zhang L. (2019). MicroRNA-210 Downregulates ISCU and Induces Mitochondrial Dysfunction and Neuronal Death in Neonatal Hypoxic-Ischemic Brain Injury. Molecular neurobiology, 56(8), 5608-5625.

+ Open protocol

+ Expand

Construction of FLAG-Tagged Fusion Proteins

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All primers used in these cloning projects are listed in Table 1 (Supplementary Material). To generate amino-terminal 3XFLAG fusion constructs, PCR was used to introduce appropriate 5′ and 3′ restriction sites to furin, syntaxin 4, and Tgn38 cDNA (Origene, Rockville, MD). The PCR products were cloned in frame to the 3XFLAG coding sequence in the p3XFLAG-CMV 7.1 expression vector (Sigma Aldrich, St. Louis, MO). The GeneTailor Site-Directed Mutagenesis system (Life Technologies) was used to create 3XFLAG-syntaxin 4+YGRL, 3XFLAG-syntaxin 4 +YKGL, and 3XFLAG-syntaxin 4 +YQRL and 3XFLAG-TGN38 _YGRL, 3XFLAG-TGN38ΔYQRL, and 3XFLAG-furinΔYKGL constructs using previously described conditions (Moore et al., 2011 (link)). The 3XFLAG-furin_YGRL mutant was constructed by three-step site-specific PCR mutagenesis (Shokeen et al., 2008 (link)) using end, mutagenic and overlapping primers listed in Table 1. The overlap extension PCR cloning method (Bryksin and Matsumura, 2010 (link)) was used to create the 3XFLAG-syntaxin 6 and 3XFLAG-syntaxin 6 ΔYGRL (both constructs previously described in Moore et al., 2011 (link)) into the pcDNA3.1mycBioID plasmid (plasmid # 35700, Addgene.org) (Roux et al., 2012 (link)). All constructs were confirmed by sequencing (Eurofins MWG Operon, Hunstville, AL).

Kabeiseman E.J., Cichos K.H, & Moore E.R. (2014). The eukaryotic signal sequence, YGRL, targets the chlamydial inclusion. Frontiers in Cellular and Infection Microbiology, 4, 129.

+ Open protocol

+ Expand

Cloning and Expression of Tom1 and Lamp2a

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA with the full-length ORF of Tom1 (NM_005488.2) and Lamp2a (NM_002294.2) was amplified by PCR with following primers 5’-GCTCTAGAATGGACTTTCTCCTGGGGAAC-3’ (forward) and 5’- GCGGATCCTCATAAGGCAAACAGCATGTCATC—3’ (reverse) for Tom1; 5’-GGGGTACCAATGGTGTGCTTCCGCCTCTT-3’ (forward) and 5’-GCGGATCCCTAAAATTGCTCATATCCAGCAT-3’ (reverse) for Lamp2a. cDNAs were then cloned into the p3XFLAG-CMV-7.1 expression vector (Sigma) to produce Flag-tagged Tom1(Pcmv-Tom1) and Flag-tagged Lamp2a (Pcmv-Lamp2a) plasmids. Cells cultured in 6-well plates were transfected with plasmids by the Lipofectamine 2000 Transfection Reagent method (Invitrogen) and harvested for further experiments at time points as indicated. Primers for human Tom1 (sense: GGCATCTTTGGGACCTTC; antisense: TCTCCAGTGGGACAGCG) and Lamp2a (sense: GGCACCCACCATACA; antisense: GGCTGAACCCTTAGATC) were used for real-time PCR to confirm the gene expression.

Ding Y., Gao H., Zhao L., Wang X, & Zheng M. (2015). Mitofusin 2-Deficiency Suppresses Cell Proliferation through Disturbance of Autophagy. PLoS ONE, 10(3), e0121328.

+ Open protocol

+ Expand

Cloning and Expressing KLF4 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

To clone KLF4 cDNA into expression vector, an ORF clone (HsCD00040749) was purchased from the Harvard-DFCI plasmid repository (https://plasmid.med.harvard.edu/PLASMID). The coding region of human KLF4 cDNA was amplified from the ORF clone and inserted into the p3XFLAG-CMV™-7.1 expression vector (Sigma-Aldrich, E7533) using EcoRV-BamHI restriction sites. Two variants of cDNA were cloned, KLF4 full length coding 479 aa long protein (aa 1–479) and KLF4 DBD coding 105 aa (aa 375–479). A Phusion Site-Directed Mutagenesis Kit (Thermo Scientific, F-541) was used to introduce a point mutation (T>G) for K409Q amino acid change in both constructs. All created constructs were confirmed by sequencing.
Transient transfections were carried out using Invitrogen™ Lipofectamine™ LTX Reagent with PLUS™ Reagent (Fisher Scientific, 15-338-100) according to the manufacturer’s instructions. Not more than 2 μg of total plasmid DNA per 10⁶ cells were used.

Tsytsykova A.V., Wiley G., Li C., Pelikan R.C., Garman L., Acquah F.A., Mooers B.H., Tsitsikov E.N, & Dunn I.F. (2022). Mutated KLF4(K409Q) in meningioma binds STRs and activates FGF3 gene expression. iScience, 25(8), 104839.

+ Open protocol

+ Expand

Cloning and Mutagenesis of Cyclin D3 and LIN-52

Check if the same lab product or an alternative is used in the 5 most similar protocols

Coding sequences for Cyclin D3 and LIN-52 were amplified by PCR from mouse pre–B cell cDNA using high-fidelity Pfu Ultra polymerase (Agilent Technologies) and ligated into the p3XFLAG-CMV7.1 expression vector (Sigma-Aldrich). Site-directed mutagenesis was performed using QuikChange kits (Agilent Technologies), and sequences were verified by direct DNA sequencing. 3xFLAG-tagged Cyclin D3 and LIN-52 cDNAs were amplified by PCR and subcloned into the MIGR1 retroviral vector.

Thompson B.J., Bhansali R., Diebold L., Cook D.E., Stolzenburg L., Casagrande A.S., Besson T., Leblond B., Désiré L., Malinge S, & Crispino J.D. (2015). DYRK1A controls the transition from proliferation to quiescence during lymphoid development by destabilizing Cyclin D3. The Journal of Experimental Medicine, 212(6), 953-970.

+ Open protocol

+ Expand

Generation of Vps11 Constructs and Tandem RFP-GFP-LC3 Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols

The FLAG-Vps11-WT plasmid was prepared by PCR from the human cDNA clone template purchased from Dharmacon (cat# MHS6278-202759639). The PCR fragment was digested with NotI and XbaI and ligated into the p3XFLAG-CMV-7.1 expression vector from Sigma-Aldrich (cat# E7533). The FLAG-Vps11-C846G construct was generated using the QuikChange Lightning Site-Directed mutagenesis kit (Agilent Technologies) as recommended by the manufacturer. The GST-Vps11-RING-WT and GST-Vps11-RING-C846G were prepared by PCR from their respective FLAG-tagged templates. The PCR fragments were digested with EcoRI and XhoI and ligated into the pGEX-6P-1 from GE Healthcare (cat# 28-9546-48). The tandem RFP-GFP-LC3 plasmid was created and kindly provided by Tamotsu Yoshimori of Osaka University, Japan [24 (link)]. Integrity of the coding sequence of these constructs was confirmed by dideoxy sequencing.

Zhang J., Lachance V., Schaffner A., Li X., Fedick A., Kaye L.E., Liao J., Rosenfeld J., Yachelevich N., Chu M.L., Mitchell W.G., Boles R.G., Moran E., Tokita M., Gorman E., Bagley K., Zhang W., Xia F., Leduc M., Yang Y., Eng C., Wong L.J., Schiffmann R., Diaz G.A., Kornreich R., Thummel R., Wasserstein M., Yue Z, & Edelmann L. (2016). A Founder Mutation in VPS11 Causes an Autosomal Recessive Leukoencephalopathy Linked to Autophagic Defects. PLoS Genetics, 12(4), e1005848.

+ Open protocol

+ Expand

Chondrocyte Transfection and NKX3-2 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfection of SW1353s or human primary chondrocytes (30.000 cells/cm²) with 100 nM of NKX3-2 siRNA duplex or a scrambled negative control siRNA (Control RNAi; small interfering RNA) was performed according to the manufacturer’s protocol, using HiPerfect (Qiagen, Hilden, Germany). NKX3-2 and the Control siRNA duplexes were custom-made by Eurogentec (Liège, Belgium) and sequences are shown in Table 1. Treatment with BMP7 was started 5 hours post-transfection, and cells were harvested 24 hours post-stimulation for further analysis. The coding sequence of human NKX-3.2 was custom synthesized (GeneCust) with optimized codon usage and cloned into p3XFLAG-CMV-7.1 expression vector (Sigma-Aldrich). FLAG-NKX-3.2 was transiently overexpressed in SW1353 (by Fugene (Promega) according to the manufacturer’s protocol) and human primary chondrocytes (by polyethyleneimine-mediated transfection) (1,000 ng of plasmid/well in 12-well plates). Cells were harvested after 24 hours.

Ripmeester E.G., Welting T.J., van den Akker G.G., Surtel D.A., Steijns J.S., Cremers A., van Rhijn L.W, & Caron M.M. (2022). BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner. PLoS ONE, 17(2), e0263430.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!