Faststart dna master sybr green 1 pcr reaction mix

For analysis of mRNA expression, brains were removed from mice immediately after the final training session (Day 12), and cortical tissue from left and right coronal slices including M1 (1.5–0 mm from the bregma) was collected with a 1.0 mm diameter biopsy needle and frozen. RNA was extracted from the cortical tissue using TRIzol reagent (Invitrogen, Carlsbad, CA). Total RNA (2 μg) was reverse‐transcribed with Superscript II and oligo‐dT, and PCR was performed on a Roche Lightcycler (Roche, Minneapolis, MN) with FastStart DNA Master SYBR Green 1 PCR reaction mix. Relative expression levels in samples from the left and right hemispheres were quantified as previously described (Lee, Cohen, Tendi, Farrer, GH DEV, Becker KG, & Fields RD., 2004). Primer sequences were as follows: a housekeeping gene, glyceraldehyde phosphate dehydrogenase (GAPDH), 5‐AATGCATCCTGCACCACCAAC‐3', 5'‐TGGATGCAGGGATGATGTTCTG‐3'; MBP, 5'‐CGATTGGGTGTCACTCTGAAA‐3', 5'‐CCCAGCAGAGAATGAACACAA‐3'. For each tissue sample, the MBP mRNA expression level was normalized to that of GAPDH mRNA. For Figure 2d, 14 WT mice (six with and eight without training) and 15 PLP‐tg mice (six with and nine without training) were used.