RNA was extracted from cells using the phenol/chloroform method and concentrations were measured using a NanoDrop spectrophotometer (ThermoFisher). Reverse transcription was performed with aliquots of 1 μg total RNA using a qScript cDNA Synthesis Kit (Quanta). Quantitative PCR was performed with SYBR Green I dye master mix (Roche) and a CFX connect Real-Time PCR System (Bio-Rad). AXIN1 primers were: forward ACAGGATCCGTAAGCAGCAC and reverse GGTACGTGCGGGGAATGT. H3A primers were used as internal controls: forward AAGCAGACTGCCCGCAAAT and reverse GGCCTGTAACGATGAGGTTTC. Primer efficiency was measured in preliminary experiments, and amplification specificity was confirmed by dissociation curve analysis.
Sybr green 1 dye master mix
Manufactured by Roche
SYBR Green I dye master mix is a ready-to-use solution containing SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffer components for real-time quantitative PCR (qPCR) applications. The SYBR Green I dye binds to double-stranded DNA, allowing for the detection and quantification of DNA targets during the PCR amplification process.
Automatically generated - may contain errors
3 protocols using sybr green 1 dye master mix
1
Quantification of AXIN1 Expression
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using a GenElute Mammalian Total RNA Purification Kit (Sigma) according to standard protocols. RNA concentration was measured using a NanoDrop spectrophotometer (ThermoFisher). cDNA was synthesized from aliquots of 1 μg total RNA using a qScript cDNA Synthesis Kit (Quanta). Quantitative PCR was performed with SYBR Green I dye master mix (Roche) and a CFX connect Real-Time PCR System (Bio-Rad). Primer sequences are listed in Supplementary Table 3 . Primer efficiency was measured in preliminary experiments, and amplification specificity was confirmed by dissociation curve analysis.
3
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using a GenElute Mammalian Total RNA Purification Kit (Sigma)
according to standard protocols. RNA concentration was measured using a NanoDrop spectrophotometer (ThermoFisher). cDNA was synthesized from aliquots of 1 μg of total RNA using a qScript cDNA Synthesis Kit (Quanta). Quantitative PCR was performed with SYBR Green I dye master mix (Roche) and a CFX connect Real-Time PCR System (Bio-Rad). Primer sequences are listed in Supplemental Table 4. Primer efficiency was measured in preliminary experiments, and amplification specificity was confirmed by dissociation curve analysis.
according to standard protocols. RNA concentration was measured using a NanoDrop spectrophotometer (ThermoFisher). cDNA was synthesized from aliquots of 1 μg of total RNA using a qScript cDNA Synthesis Kit (Quanta). Quantitative PCR was performed with SYBR Green I dye master mix (Roche) and a CFX connect Real-Time PCR System (Bio-Rad). Primer sequences are listed in Supplemental Table 4. Primer efficiency was measured in preliminary experiments, and amplification specificity was confirmed by dissociation curve analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!