Ncode mir first strand cdna synthesis kit

miRNA isolation was carried out using miRNeasy (Qiagen) in cells treated with or without prior VEGFA, saracatinib, or 5′‐azacytidine (Sigma‐Aldrich). cDNA synthesis used Ncode miR First Strand cDNA synthesis kit (Invitrogen). qPCR of miR‐128 used miR‐128 forward: 5′‐TCACAGTGAACCGGTCTCTTT‐3′ and Universal reverse primer (Ncode miR First Strand cDNA synthesis kit, Invitrogen). Three different siRNA oligos to each of SRC, BMI1, and DNMT3A and scrambled controls were purchased from Santa Cruz Biotech (Dallas). Knockdown was assayed after 48 h by Western blot as described (Zhao et al, 2014). AntagomiR‐128 and its control were purchased from Exiqon (Denmark) and transduced into cells as per manufacturer's protocol. Bmi1, pStat3, Myc, Klf4, Oct4, SrcpY416, Src, VEGFR2pY1175, VEGFR2, and DNMT3A antibodies were from Cell Signaling. β‐actin antibody was from Santa Cruz Biotech. Densitometric analysis was carried out for Western blot data using three different exposures of three different biologic assays and data presented as fold change expression ± SEM.

QPCR was performed at least thrice and mean Ct values normalized to GAPDH or 18S values. mRNA isolation used miRNeasy mini kit (Qiagen, Hilden, Germany) and cDNA synthesys used NcodemiR First-Strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). miR-452 levels were assayed by QPCR. PCR primers for EMT markers and transcription factors assayed, and for miR-452 are in Supplementary Figure S8.