The largest database of trusted experimental protocols

Rhodamine conjugated anti digoxin antibody

Manufactured by Roche

The Rhodamine-conjugated anti-digoxin antibody is a laboratory reagent used in various immunoassay techniques. It consists of an anti-digoxin antibody that has been labeled with the fluorescent dye Rhodamine. This antibody can be used to detect and quantify the presence of digoxin, a cardiac glycoside drug, in biological samples.

Automatically generated - may contain errors

2 protocols using rhodamine conjugated anti digoxin antibody

1

Chromosomal Composition Analysis of Brassica Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Multi-color FISH was conducted on meiosis metaphase I chromosomes of parent lines and putative ILs to confirm their chromosomal composition. B. nigra and CentBr (centromeric-specific tandem repeats of Brassica; accession numbers: CW978699 and CW978837, respectively; Wang G. et al., 2011 (link)) DNA were selected as probes and labeled with biotin (dig)-14-dUTP (Roche, Indianapolis, IN) using nick translation with an average length of 500 bp. Slides were prepared following a previously published protocol (Zhong et al., 1996 (link)) with minor modifications. To decompose the cell walls of pollen mother cells, anthers approximately 1–3 mm in length were digested at 37°C for 3 h in an enzyme mixture containing 6% cellulose R-10 and 6.5% pectinase (Sigma, solution in 40% glycerol). Previously described methods (Wang G. et al., 2011 (link)) were followed for FISH analysis. Hybridized probes were visualized using an FITC-conjugated avidin antibody or rhodamine-conjugated anti-digoxin antibody (Roche, Indianapolis, IN). Chromosomes were counterstained using 0.1 mg/mL DAPI (Vector Laboratories, Burlingame, CA). Images of the signals and chromosomes were captured using a CCD camera (QIMAGING, RETIGA-SRV, FAST1394) attached to a Nikon Eclipse 80i epifluorescence microscope (Tokyo, Japan). Image contrast and brightness were adjusted in Adobe Photoshop (8.0).
+ Open protocol
+ Expand
2

In Situ Hybridization of SNHG5 lncRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The SNHG5 probe, with the sequence TGCTAGTCAGTCACATTCGACA and digoxin labelled on both ends, was synthesized by QIAGEN (Germany). Cells were seeded onto chamber glass slides, fixed in 4% paraformaldehyde, digested with pepsin, and dehydrated using graded ethanol (70-100%). The slides were blocked by pre-hybridization buffer (Boster Biological Technology, Wuhan, China) for 2 hours at 54°C, followed by overnight hybridization with the SNHG5 probes in a humidified chamber at 54°C. After washing with a gradient SSC solution (Ambion), the slides were blocked with goat serum, incubated with rhodamine-conjugated anti-digoxin antibody (Roche) at 4°C overnight, washed with PBS, and mounted with DAPI (Abcam). The slides were visualized using a confocal laser scanning microscope (TCS SP8, Leica).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!