Rna solv
RNA-Solv is a reagent solution designed for the isolation and purification of RNA from various biological samples. It is a versatile tool that can be used to extract high-quality RNA from a wide range of sources, including cells, tissues, and microorganisms.
Lab products found in correlation
16 protocols using rna solv
Enhancing Knockdown Efficiency
Viral Genome Sequencing by Amplicon Library
For1, TGTACACACGGCTTTTAGGTAGA;
Rev1, GGAAAAGTGTTGCAAGAGCGA;
For2, TGTTCTTCGGGAAATGGGGA;
Rev2, TGCCTGTCCCACACGAATAG;
For3, GTTACGCGTGTCCTTTGACG;
Rev3, AACTTCCGTACCAACGCTCA;
For4, AAAGTTGCGTGGGTTTGTGG;
Rev4, CGTGTAAGCAGGGCAGATAGT.
Amplicons were purified with the NucleoSpin kit (MACHEREY-NAGEL), sheared in a Bioruptor Pico (Diagenode) by twelve cycles of 30 s of sonication and 30 s of cooling in 1.5 ml Bioruptor tubes (Diagenode), mixed in equimolar proportions, and used to prepare the library with the Next ultra II DNA library prep kit (E7645, NEB) using 1 μg of DNA per sample as input. Samples were multiplexed with barcodes (E7335, E7500, E7710, E7730, NEB), and the libraries were sequenced on an Illumina HiSeq 4000 sequencer as paired-end 100 base reads by the GenomEast platform, a member of the ‘France Genomique’ consortium. Image analysis and base calling were performed using RTA version 2.7.7 and bcl2fastq version 2.20.0.422.
Quantifying Gene Expression in T-ALL Cells
Dengue Virus Knockdown and Replicon Assay
RNA Extraction and qPCR Analysis
Hippocampal RNA Extraction and cDNA Synthesis
Meibomian Gland RNA Extraction
Total RNA Isolation and RT-qPCR Analysis
RNA Isolation and RT-qPCR Analysis
Tumor growth on chicken embryo CAM
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!