Universal adapter

Manufactured by Illumina

Universal adapters are laboratory equipment designed to facilitate the connection between various components or instruments within a scientific setup. They serve as versatile interfaces, enabling seamless integration and compatibility across different equipment and systems.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Illumina adapters (41 citations) TruSeq Universal Adapter (8 citations) Universal adapter sequence (3 citations)

13 protocols using universal adapter

RNA-seq Data Processing Pipeline

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A bioinformatics pipeline was run in Puhti supercomputer cluster of CSC (Espoo, Finland) to quantify gene expression in the samples from RNA sequencing data. Paired-end RNA-seq reads of 378 brain samples were downloaded from Sequence Read Archive in FASTQ format with SRA Toolkit (v2.10.8). Low-quality ends (Phred score < 20) and Illumina Universal Adapters were trimmed with TrimGalore (v0.6.4; https://github.com/FelixKrueger/TrimGalore; 10.5.2021). Other quality filtering was performed with following qualifiers of PRINSEQ (lite v0.20.4) [11 (link)]: read length ≥ 50 nucleotides, mean quality score of read ≥25, proportion of ambiguous bases ≤1%, filter all kinds of duplicates, DUST score measuring low complexity ≤7. Quality filtering was confirmed with FastQC (v0.11.8; https://www.bioinformatics.babraham.ac.uk/projects/fastqc; 10.5.2021). Quality reads were aligned with STAR (v2.7.1a) [12 (link)] against human reference genome (GCF_000001405.26_GRCh38_genomic.fna from NCBI).

Nevalainen T., Autio A, & Hurme M. (2022). Composition of the infiltrating immune cells in the brain of healthy individuals: effect of aging. Immunity & Ageing : I & A, 19, 45.

+ Open protocol

+ Expand

Transcriptome analysis of IFN-γ-stimulated HeLa cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were stimulated with IFN-γ (500 U/ml) for 18 hours or were left untreated. Infections with Stm were performed on individual triplicates at MOI 5. After 5 hours, cells were washed three times in sterile prewarmed DMEM, lysed in 300 μl of RLT buffer, and processed via RNeasy (Qiagen) kits per the manufacturer’s protocol. RNA was checked for quality using a denaturing MOPS gel and Nanodrop. 10 μg of sample RNA was annealed to oligo-dT beads followed by first- and second-strand cDNA synthesis (Illumina). cDNA was then pair-end–barcoded with Illumina Universal Adapters and sequenced on a HiSeq4000 sequencer. Data acquired were bin-sorted and de-barcoded through a Sickle-Schythe Pipe. FASTA files were then aligned to human reference genome HsGRCh37 by Hisat and Tophat2, yielding 95% alignment. Annotated genes were quantitated via CufflinksV2 and subsequent data were processed for visual display through CummeRbund, ggplots, and ggplot2 in R.

Gaudet R.G., Zhu S., Halder A., Kim B.H., Bradfield C.J., Huang S., Xu D., Mamiñska A., Nguyen T.N., Lazarou M., Karatekin E., Gupta K, & MacMicking J.D. (2021). A human apolipoprotein L with detergent-like activity kills intracellular pathogens. Science (New York, N.Y.), 373(6552), eabf8113.

+ Open protocol

+ Expand

RNA Extraction and Sequencing from Human Islets

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from whole human islets (Supplemental Tables1,2) was prepared immediately using the RNeasy Micro kit (Qiagen). Beta cell RNA yields were 300-500 ng from each FACS run, and RNA integrity numbers were between 9.5 and 10.0. PolyA⁺ mRNA from sorted beta cells was purified with oligo dT magnetic beads. The polyA⁺ RNA from beta cells was then fragmented in the presence of divalent cations at 94°C. The fragmented RNA was converted into double stranded cDNA. After polishing the ends of the cDNA, the 3’ ends were adenylated. Finally, Illumina-supplied universal adapters were ligated to the cDNA fragments. The adaptor ligated DNA was size selected to get an average of 250 bp insert size using AmpPure beads, and amplified by 15 cycle PCR. The PCR DNA was then purified using AmpPure beads to get the final seq library ready for sequencing. The insert size and DNA concentration of the seq library was determined on Agilent Bioanalyzer and Qubit, respectively. A pool of 10 barcoded RNA seq libraries was layered on two of the eight lanes of the Illumina flow cell at appropriate concentration and bridge amplified to yield ~25- 35 million raw clusters. The DNA reads on the flow cell were then sequenced on HiSeq 2000 using a 100 bp paired end recipe. Results are expressed as millions of counts (reads) per million bases (CPM).

Wang P., Karakose E., Liu H., Swartz E., Ackeifi C., Zlatanic V., Wilson J., González B.J., Bender A., Takane K.K., Ye L., Harb G., Pagliuca F., Homann D., Egli D., Argmann C., Scott D.K., Garcia-Ocaña A, & Stewart A.F. (2018). Combined Inhibition of DYRK1A, SMAD and Trithorax Pathways Synergizes to Induce Robust Replication in Adult Human Beta Cells. Cell metabolism, 29(3), 638-652.e5.

+ Open protocol

+ Expand

Fecal Microbiome Profiling Using 16S rRNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from 200 mg (wet weight) of fecal samples with a commercial Kit.3 The V4 region of the 16S rRNA gene was amplified with the forward (5′‐AYTGGGYDTAAAGNG‐3′) and reverse (5′‐TACNVGGGTATCTAATCC‐3′) primers14 The primers were designed with overhanging adapters (Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG,Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) for annealing to Illumina universal index sequencing adaptors that were added in a later PCR. The reaction mixture and amplification conditions have been described previously.15 The PCR products were purified with magnetic beads.4 Illumina universal adapters (Forward: AATGATACGG CGACCACCGAGATCTACAC‐index‐TCGTCGGCAGCGTC, Reverse: CAAGCAGAAGACGGCATACGAGAT‐index‐GTCTCGTGGGCTCGG) then were added to the purified 16S rRNA gene product by PCR.15 The PCR products were evaluated by electrophoresis in 1.5% agarose gel and purified as described above. After purification, spectrophotometry5 was used to quantify the PCR products. Samples were normalized to a final concentration of 2 nM. The library pool was submitted to the Genomics Facility of the University of Guelph and sequenced with an Illumina MiSeq6 for 250 cycles from each end.

Gomez D.E., Arroyo L.G., Costa M.C., Viel L, & Weese J.S. (2017). Characterization of the Fecal Bacterial Microbiota of Healthy and Diarrheic Dairy Calves. Journal of Veterinary Internal Medicine, 31(3), 928-939.

+ Open protocol

+ Expand

Illumina Sequencing Data Preprocessing

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Illumina Universal adapters were removed and reads were trimmed using Trim Galore⁶³ with a minimum read length parameter 50 bp. The resulting reads were filtered using Kraken^{37 (link)}, as described below in Section 4.3, with a custom database built from the PhiX genome (NCBI Reference Sequence: NC_001422.1). Removal of PhiX content is suggested as it is a common contaminant in Illumina sequencing data^{64 (link)}. Trimmed non-PhiX reads were used in subsequent matrix filtering and microbial identification steps.

Beck K.L., Haiminen N., Chambliss D., Edlund S., Kunitomi M., Huang B.C., Kong N., Ganesan B., Baker R., Markwell P., Kawas B., Davis M., Prill R.J., Krishnareddy H., Seabolt E., Marlowe C.H., Pierre S., Quintanar A., Parida L., Dubois G., Kaufman J, & Weimer B.C. (2021). Monitoring the microbiome for food safety and quality using deep shotgun sequencing. NPJ Science of Food, 5, 3.

+ Open protocol

+ Expand

Transcriptome Assembly and Unigene Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The raw reads were cleaned using Cutadapt-3.4 to remove bases with a quality score less than 20, alongside contamination from the Illumina universal adapters used during sequencing. The removal of adapter contaminations and low-quality reads were confirmed by using FastQC-0.11.9 resulting in high quality reads. The high-quality reads were then de novo assembled into a transcriptome using Trinity-2.12.0 that contains predicted mRNA transcripts. Transcripts generated by Trinity were clustered into groups based on shared component sequences that are loosely considered to represent the same gene. The longest transcript in each of the gene clusters was designated as a unigene and was used as a representative for downstream gene-level analyses.

Bageel A.M., Kam A, & Borthakur D. (2022). Transcriptional Analyses of Genes Related to Fodder Qualities in Giant Leucaena Under Different Stress Environments. Frontiers in Plant Science, 13, 885366.

+ Open protocol

+ Expand

Illumina Sequencing Data Preprocessing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Illumina Universal adapters were removed and reads were trimmed using Trim Galore 65 with a minimum read length parameter 50 bp. The resulting reads were filtered using Kraken 37 , as described below in Section 4.3, with a custom database built from the PhiX genome (NCBI Reference Sequence: NC_001422.1). Removal of PhiX content is suggested as it is a common contaminant in Illumina sequencing data. 66 Trimmed non-PhiX reads were used in subsequent matrix filtering and microbial identification steps.

Beck K.L., Haiminen N., Chambliss D.D., Edlund S., Kunitomi M., Huang B.C., Kong N., Ganesan B., Baker R.C., Markwell P.J., Kawas B., Davis M.A., Prill R.J., Krishnareddy H., Seabolt E., Marlowe C.H., Pierre S., Quintanar A., Parida L., Dubois G., Kaufman J.H., & Weimer B.C. (2020). Monitoring the microbiome for food safety and quality using deep shotgun sequencing.

+ Open protocol

+ Expand

Single-cell RNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RNA extraction, samples were thawed on ice. They were then washed with cold PBS and spun down in a centrifuge for 5 min at 1000 rpm to remove the buffer; this process was repeated 3 times. Cell lysis, cDNA conversion, fragmentation, and library preparation were done in single tubes using the QIAseq FX Single Cell RNA Library Kit (Qiagen). Final library amplification was performed using Q5 Hot Start polymerase (New England Biolabs), utilizing indexing primers and universal Illumina adapters obtained from the Functional Genomics Lab (FGL) at the University of California, Berkeley. Final libraries, which were constructed for each individual sample, were submitted to the FGL for library quality check via Bioanalyzer (Agilent) and subsequent 150 bp paired-end sequencing on Illumina NovaSeq 6000 S4 flow cells, attempting 37 million reads per library.

Ali N., Amelkina O., Santymire R.M., Koepfli K.P., Comizzoli P, & Vazquez J.M. (2024). Semen proteome and transcriptome of the endangered black-footed ferret (Mustela nigripes) show association with the environment and fertility outcome. Scientific Reports, 14, 7063.

+ Open protocol

+ Expand

3C-based Chromatin Interaction Mapping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Experiments were carried out as previously described (Stadhouders et al., 2013). After the first digestion and ligation the 3C DNA pool was purified with phenol/chloroform/ isoamyl alcohol (25:24:1) (Sigma). Second restriction digestion was performed by using DpnII (NEB) for 16 hours per manufacturer's instruction. Second ligation was performed at 16C for 6 hours with 200U of T4 DNA ligase. DNA was then purified again with phenol/chloroform/isoamyl alcohol (25:24:1) followed by QIAquick gel purification columns (Qiagen). Bait specific inverse PCRs were performed using primers coupled to Universal Illumina adapters and Barcode sequences. Reactions were purified by QIAquick gel purification columns. Amplicon libraries were quantified and qualified by Agilent using DNA 7500 chip cartridge. Primers are available upon request. Amplicon libraries were sequenced on Illumina HiSeq sequencer. Raw reads were demultiplexed using FASTX-Toolkit and then aligned to mm10 genome assembly (GRCm38.p1.) by BWA [50] . Bedgraph and TDF files for visualization were generated as previously described. The R package r3Cseq (pvalue<=0.05) was used to predict the putative interactions [63] .

Czimmerer Z., Horvath A., Daniel B., Nagy G., Cuaranta-Monroy I., Kiss M., Kolostyak Z., Poliska S., Steiner L., Giannakis N., Varga T, & Nagy L. (2018). Dynamic transcriptional control of macrophage miRNA signature via inflammation responsive enhancers revealed using a combination of next generation sequencing-based approaches. Biochimica et biophysica acta. Gene regulatory mechanisms, 1861(1).

+ Open protocol

+ Expand

Preparation and Sequencing of Small RNA Libraries

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs were pretreated to modify 5’ ends in two ways. For RPPH treatment, 1-2 μg of total RNA was treated with 10 units (2 μl) RNA 5’ pyrophosphohydrolase (NEB) for 1 h at 37°C. The treated RNA was phenol-chloroform extracted and ethanol precipitated with sodium acetate and glycogen for 2 days, and resuspended in RNase-free water. For CIP-RPPH treatment, 3-5 μg of total RNA was treated with 4 μl of QuickCIP (Quick dephosphorylation kit, NEB) in a total volume of 40 μl for 90-120 min at 37°C. RNA was phenol-chloroform extracted, precipitated overnight with sodium acetate and glycogen and resuspended in RNase-free water.
Small RNA libraries from treated or untreated RNA were built using the TruSeq small RNA kit (Illumina) according to the manufacturer’s instructions except for an increase in the number of PCR cycles from 11 to 15. Libraries were eluted in 0.3 M NaCl, ethanol precipitated and quantitated with Qubit and TapeStation. Libraries were pooled in groups of 6 to 12 per lane and sequenced on an Illumina HiSeq2000.
The Illumina universal adapter was trimmed from small RNA reads using cutadapt v1.10 and reads were mapped to the corresponding genome assemblies with Bowtie v0.12 (Langmead et al., 2009 (link)) with parameters –v 0 –m 1.

Beltran T., Barroso C., Birkle T.Y., Stevens L., Schwartz H.T., Sternberg P.W., Fradin H., Gunsalus K., Piano F., Sharma G., Cerrato C., Ahringer J., Martínez-Pérez E., Blaxter M, & Sarkies P. (2019). Comparative Epigenomics Reveals that RNA Polymerase II Pausing and Chromatin Domain Organization Control Nematode piRNA Biogenesis. Developmental Cell, 48(6), 793-810.e6.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!