CMS5 (murine sarcoma cells) were kindly provided from Dr. You-yong Lu, Beijing Cancer Hospital, Cancer Research Institute, China) and 4T1 (murine mammary tumor cells) were purchased from ATCC. CMS5 and 4T1 were cultured in RPMI 1640 medium (Gibco, NY, USA) supplemented with 10% FBS (Gibco, NY, USA) and 1% antibiotics (Gibco, NY, USA). To generate a VP1-expressing tumor cell line, the lentivirus encoding VP1 was codon-optimized and synthesized by GenScript (Nanjing, Jiangsu, China), then cloned into the vector pcDH-GFP-Puro (gifted by Shibo Jiang laboratory, Fudan University). The plasmid pcDH-VP1 was transfected into CMS5 using lipofectamine (Invitrogen, Carlsbad, USA) and cultivated in RPMI 1640 medium supplemented with 10% FBS in CO2 incubator at 37oC for 48 h. Puromycin (YEASEN, Shanghai, China) was added into the culture with a final concentration of 10 µg/ml. Cytotoxicity of Puromycin resulted in the complete death of CMS5 cells and survival of CMS5-VP1 cells. A single clone of CMS5-VP1 cells was selected and propagated in RPMI 1640 medium supplemented with 10% FBS and 10 µg/ml Puromycin. Flow cytometry and Western Blot analysis were performed to determine VP1 expressed in CMS5-VP1 cells.
Puromycin
Manufactured by Yeasen
Sourced in China
Puromycin is a lab equipment product used for the selection and maintenance of cells expressing a puromycin resistance gene. It is a protein synthesis inhibitor that blocks the translocation step in protein synthesis, leading to the termination of polypeptide chains.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Yeasen (6 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (6 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Peg 6000, by Merck Group (4 mentions)
Plko 1, by Addgene (3 mentions)
Polybrene, by Santa Cruz Biotechnology (3 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions)
Dna extraction kit, by Vazyme (2 mentions)
Pei max solution, by Polysciences (2 mentions)
Blasticidin s, by Yeasen (2 mentions)
Hygromycin b, by Yeasen (2 mentions)
Hek293t, by American Type Culture Collection (2 mentions)
Polyethylenimine (pei), by Polysciences (2 mentions)
Polybrene, by Merck Group (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions)
Lenticrispr v2 plasmid, by Addgene (2 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by ExCell Bio (2 mentions)
Fetal bovine serum (fbs), by Yeasen (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
46 protocols using puromycin
1
Generation of VP1-Expressing Murine Tumor Cell Line
2
Construction and Utilization of EGFP-53BP1 in H9c2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat cardiomyocyte cell line H9c2 (2–1) (H9c2 for short) was purchased from the Shanghai Cell Bank. Cervical cancer cell line HeLa and breast cancer cell line MDA-MB-436 were from ATCC (USA). DMEM complete medium was prepared by mixing DMEM medium (CORNING, New York, USA), fetal bovine serum (10% v/v, CORNING), and 100 × penicillin–streptomycin solution (1% v/v, CORNING). H9c2, HeLa and MDA-MB-436 were cultured in DMEM complete medium in a CO2 incubator at 5% CO2 and 37 °C. All cell lines were used within 10 passages after thawing from stocks.
The gene expression lentiviral vector of EGFP-53BP1 (1220 ~ 1711 aa) was constructed by directly linking EGFP to the gene sequence of human TP53BP1, and the vector map is shown in Fig.2 A. HEK 293 T cells were transfected to package the virus, and lentiviral particles were generated and collected. The construction of the gene expression lentiviral vector and the collection of lentiviral particles were performed by Yunzhou Biological Company (Guangzhou, China). Then, H9c2 was transfected to obtain H9c2 stably expressing EGFP-53BP1 (1220 ~ 1711 aa), which was called H9c2-EGFP-53BP1 and was cultured in a CO2 incubator at 5% CO2 and 37 °C using DMEM complete medium supplemented with 0.5 μg/mL puromycin (YEASEN, Shanghai, China). All cells were maintained mycoplasma-free.
The gene expression lentiviral vector of EGFP-53BP1 (1220 ~ 1711 aa) was constructed by directly linking EGFP to the gene sequence of human TP53BP1, and the vector map is shown in Fig.
3
Investigating circ_0026134-miR-3619-5p-CHAF1B Axis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral vectors coding shRNA‐circ_0026134 (sh‐circ_0026134) or NONTARGET shRNA (sh‐NC) were obtained from Geneseed (Guangzhou, China). To produce stable circ_0026134 knockdown cells, these lentiviral vectors were transfected into the 293T packaging cells (Procell). Virus particles were harvested and then used to transduce H520 and A549 cells in the presence of 8 μg/ml polybrene (Yeasen). The cells with positive transduction were selected by puromycin (Yeasen) for 10 days. MiR‐3619‐5p mimic (5′‐UCAGCAGGCAGGCUGGUGCAGC‐3′, Ribobio) and inhibitor (anti‐miR‐3619‐5p, 5′‐GCUGCACCAGCCUGCCUGCUGA‐3′, Ribobio) were chemically enhanced oligonucleotides designed to alter the expression of miR‐3619‐5p. The NONTARGET mimic (miR‐NC mimic, 5′‐CGAUCGCAUCAGCAUCGAUUGC‐3′, Ribobio) and inhibitor (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′, Ribobio) were scrambled control oligonucleotides. CHAF1B overexpressing plasmid (pcDNA‐CHAF1B) was generated by cloning human CHAF1B sequence into the pcDNA3.1 vector (Genomeditech) opened with Not I and Xba I, and nonspecific pcDNA vector was used as a control. H520 and A549 cells of ~50% confluence were transiently transfected with 50 nM of the indicated oligonucleotide and 200 ng of plasmid using lipofectamine 2000 (Life Technologies) as per the manufacturer's guidelines. The cells were harvested after 48 h for further exploration.
4
Lentiviral Knockdown of KEAP1 and NRF2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For shRNA-mediated knockdown of KEAP1 and NRF2, pLKO.1-puro-shRNA containing lentiviruses were used. The KEAP1 and NRF2 shRNA sequences are shown in Table 1 . Lentiviruses were generated as previously described,12 (link) added to the cells with 10μg/mL polybrene (Shanghai Yeasen Biotechnology, 40804ES76), and incubated for 20 hours, after which fresh growth medium was provided. Cells were selected with 5 μg/mL puromycin (Shanghai Yeasen Biotechnology, 60210ES25) 2 days after the infection.
The Sequences of NRF2 and KEAP1 shRNA for pLKO.1-Puro-shRNA Containing Lenti-Viruses
| Name | Sequence | |
|---|---|---|
| NRF2-sh1 | Forward | GATCCGGCTCCTACTGTGATGTGAAATTTCAAGAGAATTTCACATCACAGTAGGAGCTTTTTTG |
| Reverse | AATTCAAAAAAGCTCCTACTGTGATGTGAAATTCTCTTGAAATTTCACATCACAGTAGGAGCCG | |
| NRF2-sh2 | Forward | GATCCGCCGGCATTTCACTAAACACAATTCAAGAGATTGTGTTTAGTGAAATGCCGGTTTTTTG |
| Reverse | AATTCAAAAAACCGGCATTTCACTAAACACAATCTCTTGAATTGTGTTTAGTGAAATGCCGGCG | |
| KEAP1-sh1 | Forward | GATCCGGCGAATGATCACAGCAATGAATTCAAGAGATTCATTGCTGTGATCATTCGCTTTTTTG |
| Reverse | AATTCAAAAAAGCGAATGATCACAGCAATGAATCTCTTGAATTCATTGCTGTGATCATTCGCCG | |
| KEAP1-sh2 | Forward | GATCCGGCACTGCAAATAACCCATCTTTTCAAGAGAAAGATGGGTTATTTGCAGTGCTTTTTTG |
| Reverse | AATTCAAAAAAGCACTGCAAATAACCCATCTTTCTCTTGAAAAGATGGGTTATTTGCAGTGCCG | |
5
Generating Knockout Cell Lines for Molecular Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MC38, U2OS, and HCT116 cell lines were cultured in DMED medium (Gibco) with 10% FBS, 1% PS at 37 °C, and 5% CO2. SENP3−/− U2OS and Cgas−/− MC38 cell lines were generated with CRISPER/cas9 technology [49 (link)]. SENP3 forward 5′-CACCGAGCAGGTTTTTCGATGAGT-3′; SENP3-revers 5′-AAACACTCATCGAAAA ACCTGCTC-3′. Cgas sequence was referred to report of Zhijian J. Chen’s lab [50 (link)]. To establish SENP3 stably transfected cells, plasmids pCDH-SENP3, psPAX2, pMD2G were transfected into 293T cells to produce retrovirus, then these viruses were used to infect MC38 or U2OS cells. Stable cell lines were selected using 2 μM puromycin (Yeasen) for over 3 days. For cGAS inhibition, MC38 cells were treated with RU.521 (2 μg/mL) for two days before harvest. For DNA damage induction, U2OS cells or HCT116 cells were treated with doxorubicin (1 μg/mL) for 1 h and then washed with PBS two times before adding fresh DMEM medium (with 10% FBS,1% PS).
6
Lentiviral shRNA Plasmid Construction and Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral shRNA plasmids were constructed by inserting target oligonucleotides into the pLKO.1 (Addgene, #10878) plasmid. Plasmid DNA was extracted using a DNA extraction kit (Vazyme, DC112-01). Lentivirus was packaged by transfecting the plasmids with packaging vectors (psPAX and pMD2.G) and PEI MAX solution (Polysciences, #24765) into HEK293T cells. The viral supernatant was then collected, filtered with a 0.45 μm strainer, concentrated with PEG6000 (Sigma, #81253), resolved in PBS and then aliquoted for further transfection. Cells were infected with viruses and selected with puromycin (1 μg/mL, Yeasen, 60210ES25) for 72 hours. The target oligonucleotides are listed in Supplemental Table 4 .
7
Lung Endothelial Cell Targeting Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid was provided by Echobiotech (Beijing, China). Briefly, lung endothelial cell‐targeted peptides (LET and CGSPGWVRC) and LAMP‐2B were synthesized using PCR, with cDNA as a template. The LAMP‐2B‐LET gene was then recombined into the pLVX‐Puro blank plasmid using Xhol and BamHI restriction enzyme sites. The lentivirus was generated by transient transfection of HEK293T cells using the LAMP‐2B‐LET expressing vector. HUVECs seeded in a 6‐well plate were transfected with the LAMP‐2B‐LET lentivirus for 24 h. The supernatant containing the lentivirus was discarded and replaced with a fresh complete culture medium to continue the culture. After 72 h, puromycin (Yeason, Shanghai, China) was used to extract the transfected HUVECs.
8
Lentiviral-mediated knockdown of USP32 in U-87 MG cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral vector PLKO.1-TRC-Puro (Antihela, Xiamen, Fujian, China) was used to construct plasmid overexpressing short hairpin RNA targeting USP32 and shctrl plasmid. The primers for shUSP32 plasmid construction were designed based on the sequence of siUSP32-386 (Table 2 ). For lentiviral packaging, 293T cells (4 × 106/well) were seeded into 6-well plates and transfected with 3 µg shUSP32 or shctrl plasmid, 2 µg psPAX2 (Antihela), and 1 µg pMD2.G (Antihela) using Lipofectamine RNAiMAX at 37 °C. After incubation for 48 h, the lentivirus was harvested and used to infect U-87 MG cells at a multiplicity of infection of 30 with the addition of 10 µg/mL polybrene (Thermo Fisher Scientific). Forty-eight hours after infection, U-87 MG cells were treated with 1.0 μg/mL puromycin (Yeasen) for 3 days, constructing shUSP32 and shctrl U-87 MG cells.
9
Genetic Manipulation Strategies in 293FT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection with siRNA, shRNA, and cDNA was performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778-030) or lipofectamine 3000 (Thermo Fisher Scientific, L3000-015) according to the manufacturer’s instructions. We used 293FT cells (Thermo Fisher Scientific, R70007) to produce high-titer lentiviral particles, and the virus-containing medium was harvested 48 h after transfection. In addition, 2 μg/ml puromycin (YEASEN, 60210ES72) was used for the selection of transduced cells. The expression efficiency was evaluated by qPCR or western blot analysis. The sequence or order information of shRNA, and cDNA are shown in Supplementary Data 1 . The sequence of a pooled siRNA library targeting phospholipid transporter genes is shown in Supplementary Data 2 .
10
Establishment of Stable Hsd3b-dCas9-MPH-HFF Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the study, the stable Hsd3b‐dCas9‐MPH‐HFF cell line was established according to our previous study.12 Briefly, the cells were infected with the indicated concentrated lentiviral supernatants containing polybrene (10 μg/mL) (Santa Cruz) when primary HFFs grew to 80% confluence in 10‐cm dishes, and the culture supernatants were exchanged for fresh medium containing antibiotics 48 hours later. The antibiotic selection procedure was not less than 14 days, as shown in Figure S1 B. The optimized concentrations for antibiotic selection were as follows: blasticidin S (30 μg/mL), puromycin (1.5 μg/mL) and hygromycin B (50 μg/mL) (Yeasen). After construction of the stable cell lines, the cells were infected with the corresponding lentiviruses encoding the sgRNA, and the lentivirus ratio was 1:1:1 at a multiplicity of infection of 20. Two days post‐infection, the culture supernatants were renewed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!