The extraction of the total mRNA was done using the RNase Mini Kit (Qiagen, 74104) following the manufacturer's instructions (Table 2 ). On P7 collected brains, 3 μg mRNA from the three regions of interest at P7 (CTL; n = 6, IUGR; n = 6 and IUGR_Lf; n = 6) and P21 (CTL; n = 6, IUGR; n = 8 and IUGR_Lf; n = 8) were reverse transcripted to cDNA using 400 units of Moloney murine leukemia virus reverse transcriptase (Invitrogen, 28025-013), 20 units of recombinant RNAsin (Promega, N2515), 0.5 μg of random hexamers (ThermoFischer Scientific, #S0142), 2 mmol/L dNTP (Invitrogen, 10297018), and 40 mmol/L of dithiothreitol (Invitrogen, 18080093). Real-time quantitative PCR was performed with the PowerUp SYBR Green Master Mix (Applied Biosystems, A25742) and using an StepOnePlus™Real-Time PCR System (Applied Biosystems). Gene expressions were normalized using the housekeeping ribosomal gene RPS29. The results were calculated using the Livak approach and are expressed in arbitrary units (A.U) (12 (link)).
Recombinant rnasin
Manufactured by Promega
Sourced in United States
Recombinant RNasin is a ribonuclease inhibitor protein that helps maintain the integrity of RNA samples by inhibiting RNase activity. It is a recombinant form of the natural RNasin protein.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (6 mentions)
Sw 32.1 ti rotor, by Beckman Coulter (3 mentions)
M mlv reverse transcriptase, by Promega (3 mentions)
Ssofast evagreen supermix, by Bio-Rad (3 mentions)
Dithiothreitol (dtt), by Thermo Fisher Scientific (3 mentions)
Turbo dnase, by Thermo Fisher Scientific (3 mentions)
Random hexamer, by Thermo Fisher Scientific (3 mentions)
Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Igepal ca 630, by Merck Group (2 mentions)
Gradient fractionation system, by Teledyne (2 mentions)
Cfx manager software, by Bio-Rad (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Rnase mini kit, by Qiagen (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
High prime, by Roche (1 mentions)
Fastprep precellys24, by Bertin Technologies (1 mentions)
Sybr premix ex taq tli rnaseh plus green with rox, by Takara Bio (1 mentions)
Dna engine peltier thermal cycler, by Bio-Rad (1 mentions)
25 protocols using recombinant rnasin
1
Quantification of mRNA Expression
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was purified from exponentially growing cells using RNeasy®Mini Kit (Qiagen) following the manufacturer instructions. Previously, yeast cells were broken in a FastPrep Precellys24 (Bertin technologies) with glass beads in the recommended kit buffer. The sample was incubated with Turbo DNase (Ambion) and after DNase inactivation and incubation with oligo dT, cDNA was obtained with Improm-II® Reverse Transcriptase and Recombinant RNasin® (Promega) following the manufacturer instructions. The cDNA was analized by quantitative RT-PCR in a DNA Engine Peltier Thermal Cycler (Bio Rad) using the SYBR Premix Ex Taq Tli RNase H Plus Green with ROX (Takara).
Northern analysis were carried out as previously described [19 ]. CLN2 and ACT1 mRNA were detected using 32P-labeled probes obtained with HighPrime (Roche) according to the manufacturer instructions.
Northern analysis were carried out as previously described [
3
Quantifying PML mRNA Expression in HUVEC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by using the RNeasy Mini Kit (74104, Qiagen) with an additional on-column DNase digestion.
For qPCR, cDNA was synthesized using the expand reverse transcriptase (11785826001, Roche) according to manufacturer’s instructions. Briefly, 1 μg of total RNA and 200 pmol of (dT) primer (MWG-Operon) and PCR grade H2O (Qiagen) was mixed in a 11.5 μl reaction. The mixture was incubated at 65°C for 10 min in a thermocycler, immediately cooled on ice and afterwards the following components were added: 1x Reverse expand transcriptase buffer, 10 mM DTT, 1 mM of each dNTP, 20 U of recombinant RNAsin (Promega), and 50 U recombinant expand reverse transcriptase to make a total volume of 20 μl. The mixture was then incubated at 43°C for 1 h and the synthesized cDNA was used for subsequent qPCR. To quantify PML mRNA expression in HUVEC, qPCR amplification was performed in a 10 μl reaction volume using Taqman universal PCR master mix according to manufacturer’s recommendations (Applied Biosystems Cat.No 4364341). The following Taqman gene expression assays were used: PML- Hs 00231241; GAPDHHs 02758991 and qPCR was performed in a Stratagene MX3000P thermocycler using the following thermo profile: hold at 50°C for 2 min, followed by initial denaturation at 95°C for 20 sec, followed by 40 amplification cycles each at 95°C for 3 sec and 60°C for 20 sec period.
For qPCR, cDNA was synthesized using the expand reverse transcriptase (11785826001, Roche) according to manufacturer’s instructions. Briefly, 1 μg of total RNA and 200 pmol of (dT) primer (MWG-Operon) and PCR grade H2O (Qiagen) was mixed in a 11.5 μl reaction. The mixture was incubated at 65°C for 10 min in a thermocycler, immediately cooled on ice and afterwards the following components were added: 1x Reverse expand transcriptase buffer, 10 mM DTT, 1 mM of each dNTP, 20 U of recombinant RNAsin (Promega), and 50 U recombinant expand reverse transcriptase to make a total volume of 20 μl. The mixture was then incubated at 43°C for 1 h and the synthesized cDNA was used for subsequent qPCR. To quantify PML mRNA expression in HUVEC, qPCR amplification was performed in a 10 μl reaction volume using Taqman universal PCR master mix according to manufacturer’s recommendations (Applied Biosystems Cat.No 4364341). The following Taqman gene expression assays were used: PML- Hs 00231241; GAPDHHs 02758991 and qPCR was performed in a Stratagene MX3000P thermocycler using the following thermo profile: hold at 50°C for 2 min, followed by initial denaturation at 95°C for 20 sec, followed by 40 amplification cycles each at 95°C for 3 sec and 60°C for 20 sec period.
4
Transcription of tRNA Sequences
5
In vitro Transcription and Primer Extension Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
In vitro transcription reactions and the primer extension assay were performed essentially as previously described (22 (link)). Twenty-five microliter reactions containing 125 µg nuclear extract, 32.5 mM HEPES (pH 7.6, K+), 20 mM KCl, 6.25 mM MgCl2, 0.05 mM ethylenediaminetetraacetic acid (EDTA), 5% glycerol, 1 mM DTT, 1% PEG (Sigma product number P2263, MW:15–20 kD), 10 µg/ml α-amanitin (where indicated), 2 units Promega Recombinant RNasin, 20 ng/µl plasmid template and 4.8 ng/µl recombinant M1BP (where indicated) were incubated at 24°C for 30 min. After pre-initiation complex formation, ribonucleoside triphosphates were added to a concentration of 0.5 mM and transcription occurred for 20 min at 24°C. Reactions were stopped by addition of 0.8% SDS, 16 mM EDTA, 160 mM NaCl, 0.2 mg/ml Torula yeast RNA and 0.08 mg/ml Proteinase K and incubated for at least 5 min at room temperature. Primer extension assays were then performed as previously described (23 (link)) and analyzed on a 10% sequencing gel containing 8 M urea.
+ Expand
In vitro transcription reactions and the primer extension assay were performed essentially as previously described (22 (link)). Twenty-five microliter reactions containing 125 µg nuclear extract, 32.5 mM HEPES (pH 7.6, K+), 20 mM KCl, 6.25 mM MgCl2, 0.05 mM ethylenediaminetetraacetic acid (EDTA), 5% glycerol, 1 mM DTT, 1% PEG (Sigma product number P2263, MW:15–20 kD), 10 µg/ml α-amanitin (where indicated), 2 units Promega Recombinant RNasin, 20 ng/µl plasmid template and 4.8 ng/µl recombinant M1BP (where indicated) were incubated at 24°C for 30 min. After pre-initiation complex formation, ribonucleoside triphosphates were added to a concentration of 0.5 mM and transcription occurred for 20 min at 24°C. Reactions were stopped by addition of 0.8% SDS, 16 mM EDTA, 160 mM NaCl, 0.2 mg/ml Torula yeast RNA and 0.08 mg/ml Proteinase K and incubated for at least 5 min at room temperature. Primer extension assays were then performed as previously described (23 (link)) and analyzed on a 10% sequencing gel containing 8 M urea.
6
Pooled RNA Isolation and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After sorting the cells were lysed and subjected to combined DNA/ RNA isolation with the QIAGEN DNA/RNA/miRNA AllPrepKit (QIAGEN, Hilden, Germany).
For the gene expression profiling experiments RNA from the sorted healthy control TCRγδ+ T cell subsets was pooled in order to obtain higher amounts of RNA and to create pooled healthy control subset samples; N = 3 for Vδ1 and Vδ2 subsets, N = 8 for naive, TemRO and TemRA subsets due to lower sorting yields.
For RQ-PCR tests cDNA was synthesized from isolated RNA as well as cryopreserved RNA with reverse transcriptase Superscript II (Invitrogen Life Technologies, Waltham, MA, USA), 10x CA buffer (0.2 M Tris pH 8.3, 0.5M KCl), dNTP (GE Healthcare, Cleveland, OH, USA), dithiotreitol (Invitrogen Life Technologies), MgCl2 (Applied Biosystems Life Technologies, Waltham, MA, USA), recombinant RNAsin (Promega, Fitchburg, WI, USA) and random primers (Invitrogen Life Technologies).
For the gene expression profiling experiments RNA from the sorted healthy control TCRγδ+ T cell subsets was pooled in order to obtain higher amounts of RNA and to create pooled healthy control subset samples; N = 3 for Vδ1 and Vδ2 subsets, N = 8 for naive, TemRO and TemRA subsets due to lower sorting yields.
For RQ-PCR tests cDNA was synthesized from isolated RNA as well as cryopreserved RNA with reverse transcriptase Superscript II (Invitrogen Life Technologies, Waltham, MA, USA), 10x CA buffer (0.2 M Tris pH 8.3, 0.5M KCl), dNTP (GE Healthcare, Cleveland, OH, USA), dithiotreitol (Invitrogen Life Technologies), MgCl2 (Applied Biosystems Life Technologies, Waltham, MA, USA), recombinant RNAsin (Promega, Fitchburg, WI, USA) and random primers (Invitrogen Life Technologies).
7
Amplified Probe Set Synthesis and Labeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amplified probe set was in vitro transcribed using a HiScribe T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, E2050S). Each probe set was prepared as follows: 10 μl PCR product, 10 μl NTP buffer mix (from HiScribe kit), 2 μl T7 Polymerase mix (from HiScribe kit), 0.5 μl Recombinant RNasin (Promega, N2511), and 7.5 μl ddH2O. The samples were incubated at 37°C in the PCR machine for 4 h. For reverse transcription and fluorophore attachment, M‐MuLV Reverse Transcriptase (New England BioLabs, M0253L) was used. Each probe was prepared as follows: 7 μl dNTPs (New England BioLabs, N0447S), 7 μl 10× M‐MuLV Buffer, 10 μl of 100 μM A594‐labeled forward primer, 1.2 μl M‐MuLV enzyme, 1.4 μl Recombinant RNasin, 13.4 μl nuclease‐free water, and 30 μl RNA from the T7 reaction. The reaction mix was incubated at 50°C for 2 h.
8
Optimized RNA-Protein Binding Assay
9
SARS-CoV-2 Spike Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells were transiently transfected with plasmids containing the native SARS-CoV-2 S mRNA sequence, either wild type or mutated (U22741C) in the S VAIT element. Cells were treated with lentivirus particles pseudotyped with full-length SARS-CoV-2 spike protein (Genecopoeia, Rockville, MD #SP101-100) 48 h after transfection at a concentration of 6.62 × 104 TU/106 cells for 24 h. Bald lentiviral pseudovirion particles without the S protein were used as a control. Following lentivirus treatment, cytoplasmic extracts were prepared and resolved by centrifugation for 18 h at 17,000 rpm using 5% to 50% linear sucrose density gradients in polysome buffer (10 mM HEPES [pH 7.5], 100 mM KCl, 2.5 mM MgCl2, 1 mM DTT, 50 U recombinant RNasin [Promega, Madison, WI], and 0.1% NP-40). Fractions were collected using an ISCO gradient fractionation system equipped with a UA-6 detector. Total RNA from these fractions was isolated by TRIzol extraction (Invitrogen) and used for reverse transcription (RT)-PCR with primers specific for the SARS-CoV-2 S gene (SRTF [5′-CGCTTGTTAAACAACTTAGCTC -3′] and SRTR [5′- CCCTTTCCACAAAAATCAACTC -3′], 256 bp product) and the human GAPDH gene (GAPDHRTF [5′- GACCACAGTCCATGCCATCACTGC -3′] and GAPDHRTR [5′- TGTTGCTGTAGCCAAATTCGTTG -3′], 443 bp product).
10
RNA Extraction from T84 Monolayers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Membranes with OMV- and VCC-challenged, and sham-treated T84 tight monolayers were cut out, washed two times with RNase-free PBS and frozen in RTL-buffer (RNeasy Mini Kit; Qiagen, Sollentuna, Sweden) supplemented with 0.1 M 2-mercaptoetanol and stored at −80 °C until RNA extraction. Total RNA was extracted by using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions and dissolved in RNase-free water. RNase inhibitor, recombinant RNasin (1000 units/mL; Promega, Madison, WI, USA), was added to each sample and samples were stored at −80 °C until analysis of microRNA and mRNA expression levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!