Pv830 pneumatic picopump

Fertilized zebrafish (Danio rerio) eggs were incubated at 28 °C in Danieau’s solution and cultured under standard laboratory conditions. At 48 h post-fertilization, the embryos were dechorionated using forceps and anesthetized with 0.04 mg/ml tricaine. The embryos were then transferred to a modified agarose gel for microinjection. Before injection, tumor cells were labeled in vitro with 2 g/ml DiI, and ~100–500 cells were resuspended in serum-free DMEM. A 5 nl volume of the tumor cell solution was injected into the perivitelline cavity of each embryo using a Pv830 Pneumatic Picopump (World Precision Instruments, Sarasota, FL, USA) and non-filamentous borosilicate glass capillary needles (1.0 mm diameter; World Precision Instruments). The embryos were immediately transferred to culture water and maintained at 28 °C. Tumor growth and invasion were monitored every other day under a SM2645 fluorescence microscope (Nikon).

A gene encoding CpBV-H4 containing N-terminal tail (vH4) and truncated CpBV-H4 (vH4T) after deleting N-terminal tail was cloned into a pIB vector [17 (link)]. The recombinant plasmid (250 ng/μL) was mixed in an equal volume of Metafectene PRO transfection reagent (Biontex, Planegg, Germany) and incubated for 20 min at room temperature to allow the formation of DNA-lipid complex. A total of 100 nL of this DNA-lipid complex was injected into the hemocoel of NP3 larvae at a rate 10 nL/sec using microsyringe pump controller (PV830 Pneumatic Pico Pump, World Precision Instruments, Sarasota, FL, USA) under a microscope (Olympus S730, Tokyo, Japan). At 48 h post-infection, transient expression of vH4 was confirmed by RT-PCR using forward primer 5′–GGATCCATGGCTGATCATCCTAAAGG–3′ and reverse primer 5′–GAATTCTCAACCTCCATAACCATAGATC–3′. The expression of vH4T was determined using forward primer 5′–GGATCCATGGGAAGAGGATTGGGCAA–3′ and reverse primer 5′–GAATTCTCAACCTCCATAACCATA GATC–3′. Total RNA of larvae expressing vH4 or vH4T was extracted using Trizol reagent described below for subsequent RNA-Seq analysis.

To transiently express the following DNA constructs: pT2-huc:Gal4-VP16, pT2-uas:tRFP, uas:memYFP, pT2-uas:SYP-EGFP [60 (link)], and mnx1X3:GAL4, the constructs were diluted to a concentration of 40 ng/μl and microinjected, using a micromanipulator and a PV830 Pneumatic PicoPump (World Precision Instruments, Sarasota, FL), into one-cell-stage eggs. The embryos were kept in Petri dishes, and the pattern of EGFP expression was monitored throughout their development. The fmr1-/- line was kindly provided by Dr. Gordon X. Wang and Prof. Philippe Mourrian (Stanford University, CA). To minimize genetic variations, heterozygous (fmr1+/-) zebrafish were crossed and their progeny genotyped. Either fmr1-/- and its sibling WT adults or their progeny were used in each experiment.

Fertilized chicken eggs (Gallus gallus, Charles River, SPAFAS) were prepared for surgical manipulations as follows. Embryos were incubated to Hamburger and Hamilton stage 10 [HH 10 (Hamburger and Hamilton, 1951 (link)) (approximately 36 h)] and then a small hole was made in the shell directly over the embryo after removing 1.0 ml of albumin. Sharpened tungsten needles were used to excise the anterior neural folds of embryos. RCAS-Wnt3a or RCAS-AP virus injections were carried out using a PV830 Pneumatic Picopump (World Precision Instruments Sarasota, FL, United States). Approximately 100–150 nl of virus solution was injected into the mesenchyme on each side of the forebrain of HH10 embryos. The hole was covered with tape and the embryos were returned to the incubator. Injected embryos were collected at 72 h post treatment. Embryos were removed from the eggs, rinsed in ice-cold PBS, fixed in 4% paraformaldehyde over-night at 4°C, and taken through a graded ethanol series to dehydration. Then prepared for whole mount in situ hybridization.

The adeno-associated virus (AAV) injection method used to knock down the dopamine D1 receptor and the following behavioral evaluation were performed as described in our previous study [9 (link),10 (link)]. The AAV construct that expresses artificial microRNA (miRNA) targeting the dopamine D1 receptor with an emerald green fluorescent protein (EmGFP) under the control of the elongation factor (EF)1α promoter only in the presence of Cre recombinase (AAV10-EF1α-double-floxed inverted (DIO)-EmGFP-D1miRNA), an AAV construct that expresses control miRNA in the same arrangement (AAV10-EF1α-DIO-EmGFP-control), and an AAV construct that expresses Cre recombinase under the CMV promoter (AAV10-CMV-Cre) were produced as previously described [9 (link)]. After anesthetized with sodium pentobarbital, 8-week-old Crl:CD1 male mice were injected with 0.5 μL of the AAV solution (1.0 × 10¹² genomics copies/mL) per site, applied at two sites in the hippocampal regions of both hemispheres (four sites per mouse; from bregma: posterior, −3.5 mm; lateral, ± 3 mm; ventral, −3.8 mm and −1.8 mm) according to the atlas of Paxinos and Franklin [11 ] and using a PV-830 Pneumatic PicoPump (World Precision Instruments, Sarasota, FL, USA). Mice were allowed to recover for 4 weeks and then used for the Y-maze test.

The rat experiments were conducted with approval from the University of California San Diego Institutional Animal Care and Use Committee (protocol # S19030). All rats (Sprague-Dawley) were all male, and 3 months old. Acute in vivo electrophysiological recordings were performed on the rat primary somatosensory “barrel” cortex (S1) with the µECoG electrode and the µSEEG electrode. The rat was anesthetized and craniotomy was performed under isofluorane anesthesia. The body temperature of the rat was maintained at 37 °C with a heating pad. Craniotomy and dura removal were performed over the right barrel and surrounding cortical region. Following electrode placement, the rat was transitioned to ketamine/xylazine anesthesia for recording. Tactile stimulation was performed by delivering air puffs to the whisker pad. Air puffs were pressure-injected through a glass micropipette using a PV830 pneumatic picopump (World Precision Instruments, Inc.) with 1 s pulses (n > 10 trials per location). The contralateral (left) whiskers with respect to the recording sites were deflected by air puff (±2 mm). First, the whole contralateral whiskers (multi-whisker) were stimulated. Then single whiskers (C1-3, D1-3, E1-4) were stimulated by placing the pipette as close as possible to each whisker to avoid deflection of the neighboring whiskers. Recording data were collected for 60 s for each whisker.