Sybr green

Manufactured by DBI Bioscience

Sourced in Germany

SYBR Green is a fluorescent dye used in molecular biology applications for the detection and quantification of DNA. It binds to double-stranded DNA and emits a fluorescent signal upon excitation, allowing researchers to monitor the amplification of DNA during real-time PCR (polymerase chain reaction) experiments.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using sybr green

Quantitative Analysis of CREB1 and miR-582-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cultured cells or frozen cardiac muscle tissue were lysed using RNAiso Plus (Cat: 9109; Takara Bio Inc.) for total RNA extraction and then reversely transcribed using Bestar^TM qPCR RT Kit (Cat: DBI‐2220; DBI Bioscience) to obtain complementary DNA (cDNA).³⁷ The cDNA was mixed with SybrGreen (Cat: DBI‐2143; DBI Bioscience) and primers according to the manufacturer's instructions for qRT‐PCR reactions. The gene expression was normalized to that of GAPDH using the 2‐∆∆Ct method.³⁹ Primers used for the research are as follows:
CREB1‐forward (F) CTGGAGTTGTTATGGCGTCC, CREB1‐reverse (R) TACGACATTCTCTTGCTGCCT; mmu‐miR‐582‐5p‐F CGGCGCATACAGTTGTTCAAC, mmu‐miR‐582‐5p‐R ACTGCAGGGTCCGAGGTATT.

Niu R., Wang L., Yang W., Sun L., Tao J., Sun H., Mei S., Wang W., Feng K., Qian D, & Bai X. (2022). MicroRNA‐582‐5p targeting Creb1 modulates apoptosis in cardiomyocytes hypoxia/reperfusion‐induced injury. Immunity, Inflammation and Disease, 10(11), e708.

+ Open protocol

+ Expand

Quantification of Cxxc5 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent was used to extract total RNA from single-cell suspensions of erythrocytes removed from mouse spleens. The isolated RNA was transcribed into cDNA by reverse transcriptase (Thermo scientific, K1622). Then, the quantification of target and reference genes was performed using SYBR green (DBI Bioscience, DBI-2043) and StepOnePlus real-time PCR instruments. Target gene expression was normalized to the expression of Gapdh (Sangon Biotech, B662304). The following primer sequences were used: Cxxc5 forward, TCAGGCAAGAAGAAGCGGAAA; Cxxc5 reverse, ACGGAAGCATCACCTTCTCCA; Gapdh forward, GGTTGTCTCCTGCGACTTCA; Gapdh reverse, TGGTCCAGGGTTTCTTACTCC.

Wu J., Xiao J., Bai M., Shi C., Xin Y., Zhao W., Gao X., Yin M, & Zhao J. (2023). Single-Cell RNA Sequencing Reveals Unique Alterations in the Immune Panorama and Treg Subpopulations in Mice during the Late Stages of Echinococcus granulosus Infection. Infection and Immunity, 91(5), e00029-23.

+ Open protocol

+ Expand

IL-37 Expression Quantification in PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

After PBMCs isolation, TRIzol Reagent (Invitrogen, USA) was used to extract the total RNA. All step were performed according to manufactures’ instructions. 1μg of total RNA was reversely transcribed into cDNA via ReverTra Ace RT Master Mix with gDNA Remover (TOYOBO, Japan). RT-PCR was carried out on the ABI 7500 RT-PCR system using SYBR Green (DBI Bioscience, Germany). The primers employed in the current study are given below: IL37 forward:5’- TTCTTTGCATTAGCCTCATCCTT-3’, reverse: 5’-CGTGCTGATTCCTTTTGGGC-3’ GAPDH forward: 5’-CCGGTACTCGTTTGACTCCT-3’, reverse:5’-TGCTTCACCACCTTCTTGATG-3’. The calculation of the target gene relative expression was carried out using the 2^{-ΔΔ CT} method. Normalization was achieved with GAPDH.

Gao S., Wang J., Zhang Q., Shu J., Li C., Li H, & Lin J. (2021). Cytokine antibody array-based analysis of IL-37 treatment effects in asthma. Aging (Albany NY), 13(17), 21729-21742.

+ Open protocol

+ Expand

Generating Mutant FGFR1 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wildtype (WT) FGFR1 was generated by PCR mutagenesis of a cDNA encoding FGFR1 as previously described [25 (link)]. Mutant FGFR1 (c.2008G>A, p. E670K) was created by the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, USA) according to the manufacturer's instructions. WT and mutant FGFR1 cDNA were, respectively, subcloned into pcDNA3.1+ (Invitrogen, Carlsbad, USA). The sequences of the plasmids were confirmed by Sanger sequencing, and then they were each transiently transfected into HEK (293) cells using Lipofectamine 3000 (L3000-015, Invitrogen, USA). Whole cell lysates were collected for RNA and protein extraction 48 h after transfection. For RNA extraction, the cells were harvested using TRIzol followed by RNAiso plus (Takara, China) according to the manufacturer's instructions. RNA was then converted to cDNA using the PrimeScript™ RT Master Mix (Takara, China). The quantitative PCRs were prepared with SYBR Green (DBI® Bioscience) and were performed in a Roche LightCycler 480 detection system (the primer sequences are shown in the supplementary materials (available here)). In terms of protein levels, after lysing the cells using RIPA buffer with proteinase inhibitors (Invitrogen), the proteins were separated with 8% SDS-polyacrylamide electrophoresis after denaturation and then analyzed by western blotting.

Ying H., Sun Y., Wu H., Jia W., Guan Q., He Z., Gao L., Zhao J., Ji Y., Li G, & Xu C. (2020). Posttranslational Modification Defects in Fibroblast Growth Factor Receptor 1 as a Reason for Normosmic Isolated Hypogonadotropic Hypogonadism. Oxidative Medicine and Cellular Longevity, 2020, 2358719.

+ Open protocol

+ Expand

Quantifying STING Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rats were anesthetized with pentobarbital (2%, 40 mg/kg) and killed, and the DRGs were quickly removed and stored in liquid nitrogen as previously described [31 (link)]. Total RNA was isolated using RNA-Easy Isolation Reagent (Vazyme Biotech, China), and complementary DNA (cDNA) was generated using a cDNA Synthesis Kit (DBI Bioscience, Germany) according to the manufacturer’s instructions. RT–qPCR was carried out using SYBR Green (DBI Bioscience, Germany) and the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, USA). Relative gene expression levels were calculated by the comparative cycle threshold (CT; 2^−ΔΔCt) method. GAPDH was used as a housekeeping gene. The sequences of primers specific for STING and GAPDH were as follows:
STING: sense: 5′-CAGCCTGATGAGCCTTTGGATGAC-3′;
Antisense: 5′-GGACTGGACATGGCACAACTCTTC-3′;
GAPDH: sense: 5′-GGTGGACCTCATGGCCTACA-3′;
Antisense: 5′-CTCTCTTGCTCTCAGTATCCTTGCT-3′.

Zhang Y., Wang W., Gong Z., Peng Y., Li X., Zhang Z., Zhang X., You X, & Wu J. (2022). Activation of the STING pathway induces peripheral sensitization via neuroinflammation in a rat model of bone cancer pain. Inflammation Research, 72(1), 117-132.

+ Open protocol

+ Expand

Real-Time PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cell with density of 2×10⁶/well RNA was extracted using TRIzol reagent (cat. no. 15596026; Thermo Fisher Scientific, Inc.). According to the manufacturer's protocols, total RNA was reverse transcribed with mRNA reverse transcription kit (Bestar; cat. no. DBI-2220; DBI Bioscience) The resulting cDNA was used as template for RT-qPCR using SYBR-Green (cat. nos. QPK-201 and QPK-201T; Toyobo Life Science). Amplification with 95°C 5 sec (denaturation), 55°C 10 sec (annealing) and 72°C 15 sec (extension) was followed by a melting curve analysis with continual fluorescence data acquisition during the 55–95°C melt. The threshold cycle (CT) values were normalized to GAPDH and the relative expression was calculated by the ΔΔCq method (15 (link)). The RT-qPCR primer sequences are shown in Table II. The experiment was repeated three times.

Lu Q.L., Zheng Z.X., Ye Y.H., Lu J.Y., Zhong Y.Q., Sun C., Xiong C.J., Yang G.X, & Xu F. (2022). Macrophage migration inhibitory factor takes part in the lumbar ligamentum flavum hypertrophy. Molecular Medicine Reports, 26(3), 289.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!