The largest database of trusted experimental protocols

Trifluoracetic acid tfa

Manufactured by Merck Group
Sourced in Germany

Trifluoroacetic acid (TFA) is a colorless liquid chemical compound commonly used in laboratory settings. It serves as a strong organic acid with a pungent odor. TFA is often utilized as a reagent or solvent in various analytical and synthetic procedures, particularly in the fields of organic chemistry and biochemistry.

Automatically generated - may contain errors

15 protocols using trifluoracetic acid tfa

1

Cholesterol-tagged DNA Encapsulation and pH Sensing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cholesterol-tagged DNA (sequence: 5ʹ (Cy3)-ACCAGACAATACCACACAATTTT-CholTEG 3ʹ, HPLC purified) and the Cy-5 labeled triplex-forming DNA (sequence: 5ʹ Cy5-TTCTCTTCTCGTTTGCTCTTCTCTTGTGTGGTATTGTCTAAGAGAAGAG 3ʹ, adapted from Green et al.36 (link), HPLC purified) were purchased from Biomers or Integrated DNA Technologies. Both DNA sequences were encapsulated in microfluidic droplets at a concentration of 1.5 μM and 1 μM, respectively. For the calibration measurement (Fig. 3b), the aqueous solution inside the droplets additionally contained 50 mM potassium phosphate buffer at the respective pH. Propylamine (from Sigma Aldrich) and Trifluoracetic Acid (TFA, from Sigma Aldrich) were flushed to dynamically change the pH of the droplets’ aqueous phase. For the co-encapsulation of the DNA together with the E. coli (OD600 ≈ 20), a two-inlet droplet formation device was used (see Supplementary Fig. 7). Droplets were sealed in an observation chamber for confocal fluorescence imaging experiments.
+ Open protocol
+ Expand
2

Recombinant Protein Expression in Pichia

Check if the same lab product or an alternative is used in the 5 most similar protocols
All oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). Accuprime High Fidelity (HF) Taq Polymerase System, the EasySelect Pichia Expression Kit (including the vector pPICZαA), Zeocin, ultra-pure agarose, and TOP10 chemically competent E. coli were purchased from Invitrogen (Carlsbad, CA). All restriction enzymes, T4 DNA Ligase, and additional PCR supplies were purchased from New England Biolabs (Ipswich, MA). GFX gel band purification system was purchased from GE Healthcare (Piscataway, NJ). QIAquick PCR purification system was purchased from Qiagen (Valencia, CA). Sep-Pak Light C-18 cartridges were purchased from Waters Division (Milford, MA). Centriprep ultrafiltration units were purchased from Millipore (Billerica, MA). Trypsin, trifluoracetic acid (TFA), and all salts were purchased from Sigma-Aldrich (St. Louis, MO). Yeast media reagents, Whatman DEAE cellulose, and acetonitrile (ACN) were purchased from Fisher Scientific (Pittsburgh, PA).
+ Open protocol
+ Expand
3

Formulation and Characterization of Polymeric Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
PRA base (PRAB) and salt
(PRAS) were purchased from Cangzhou Enke Pharma-tech Co. Ltd. (China).
Acetonitrile (>99.9%), phosphate-buffered saline (PBS) tablets
(pH
7.4), PVA 9–10 kDa, PVA 31–50 kDa, PEG10,000, sorbitol,
and trifluoracetic acid (TFA) were purchased from Sigma-Aldrich (Dorset,
UK). Gantrez S-97 and PVP (MW 58 kDa), sold under the product brand
name Plasdone K-29/32, were obtained from Ashland (Worcestershire,
UK). Microcrystalline cellulose (MCC) was purchased from DFE Pharma
(Klever Strasse, Germany). Anhydrous citric acid and anhydrous sodium
carbonate (Na2CO3) were obtained from BDH Laboratory
Supplies (Dorset, UK). LCMS/MS grade methanol and formic acid were
purchased from Sigma-Aldrich (Gillingham, UK), with ultrapure water
(18.2MΩ-cm) produced in-house using a Millipore water purification
system (Millipore, Cork, Ireland).
+ Open protocol
+ Expand
4

HPLC-MS Vasopressin Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
HPLC-grade ethanol (dehydrated) was purchased from Biosolve B.V. (Valkenswaard, The Netherlands). Xylene (>99%), HPLC-grade acetonitrile (ACN; >99.93%), 2,5-dihydroxybenzoic acid (DHB; >99.0%), and trifluoracetic acid (TFA; 99%) were from Sigma-Aldrich (Zwijndrecht, The Netherlands). Vasopressin standard (synthetic [Arg8]-vasopressin (AVP)) was purchased from AnaSpec Inc. (Fremont, CA, USA).
+ Open protocol
+ Expand
5

Caffeic Acid Formulation Development

Check if the same lab product or an alternative is used in the 5 most similar protocols
All reagents, standards, and solvents were used as analytical grade. Caffeic acid (≥98%, HPLC) was purchased from Sigma-Aldrich Chemie GmBh (Steinheim, Germany). d(+)-glucose monohydrate, starch, hypromellose, poloxamer 407 (Kolliphor P 407), β-cyclodextrin, and PROSOLV SMCCTM 50 were obtained from Sigma-Aldrich GmbH (Buchs, Switzerland) and (Penwest, UK), respectively, and all were used as excipients. Ethanol (96%) was purchased from AB “Vilniaus degtine” (Vilnius, Lithuania). Phosphate-buffered saline (PBS) (pH~7.4) was obtained from Gibco (Paisley, UK). Ultrapure water was produced using a water purification system Milli-Q® (Millipore, Arlington, MA, USA). Chromatographic grade acetonitrile and trifluoracetic acid (TFA) were obtained from Sigma-Aldrich Chemie GmbH (Steinheim, Germany).
+ Open protocol
+ Expand
6

Synthesis and Solubilization of GarKS Bacteriocin

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic peptides GakA, GakB, and GakC, which constitute the bacteriocin GarKS, were synthesized by Pepmic Co., Ltd., Suzhou, Jiangsu, China, with >95% purity. The peptides were solubilized in 0.1% (vol/vol) trifluoracetic acid (TFA; Sigma-Aldrich).
+ Open protocol
+ Expand
7

Customized Microfluidic Insulin Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
Veroclear and SUP706 were purchased from Stratasys (Rehovot) as 3D‐printing and supporting materials, respectively. The stainless‐steel springs were purchased from Tohatsu. Polyurethane films, 100 μm in thickness, and Teflon molds, were obtained from CY International and 3DMD, respectively. Rubber piston stoppers were obtained by disassembly from a 0.3 ml BD ultra‐fine insulin syringe. Medical epoxy (Epo‐tek 301) was purchased from Epoxy Technology. Phosphate‐buffered saline (PBS) and formalin were obtained from Thermo Fisher Scientific. The check valves were purchased from Minivalve. Trifluoracetic acid (TFA) was purchased from Sigma‐Aldrich. Exenatide (MW = 4187 Da) was purchased from Cosmogenetech. Both insulin and glucagon were obtained from NovoNordisk.
+ Open protocol
+ Expand
8

Quantitative Proteomics Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ammonium Bicarbonate (NH4HCO3, 99.5%), trypsin (proteomics grade), α-cyano-4-hydroxy-transcynnamic acid (α-CHCA, 99,0%), water (HPLC grade), trifluoracetic acid (TFA, 99,0%), methanol (HPLC grade), acetone, protease inhibitor cocktail and protein standards for protein molecular weight marker were purchased from Fluka-Sigma Aldrich S.r.l. (Milan, Italy). Protein standards and reagent for protein quantification were acquired by Bio-Rad's Laboratories, Inc. (Monza, Italy). iTRAQ reagents and buffers were obtained from Applied Biosystems (Foster City, CA). Peptide and protein standards, for mass spectrometer external calibration, were prepared from the Sequazime peptide mass standard kit (Applied Biosystems, Framingham, MA, USA).
+ Open protocol
+ Expand
9

Nanoemulsion Preparation of Surfactin

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nanoemulsion concentrate was prepared as follows: 50% of sodium surfactin powder, 30% of 2-(2 ethoxyethoxy) ethanol (trade name Transcutol HP; Gattefossé SAS, Saint-Priest, France) and 20% of ascorbyl tetraisopalmitate (trade name Nikkol VC-IP, Nicco Chemicals Co. Ltd., Tokio, Japan) were subjected to ultrasound for 20 min, at 50 °C, as previously described [7 (link)]. Concentrates were organoleptically inspected for the absence of any thickenings. In case there were none, the obtained pre-concentrate was diluted in a glass beaker, 50 mg to 10 mL of water at temperature 37 °C, and further stirred on a magnetic stirring plate.
surfactin was obtained from microbial fermentation with B. subtilis natto KB1, as described before [7 (link),43 (link)]. All medium components were purchased from BioShop LabEmpire (Rzeszow, Poland). All solvents for chromatographic separations were of HPLC and/or MS grade for HPLC and MS analyses, respectively. Trifluoracetic acid (TFA) and surfactin standards were purchased from Sigma Aldrich.
+ Open protocol
+ Expand
10

Solvent Preparation for LC-MS Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Acetonitrile (HiPerSolv Chromanorm of LC–MS grade) was purchased from VWR Chemicals (Radnor, USA). Petroleum ether (per analysis; 40–65%) was purchased from PENTA chemicals (Prague, Czech Republic). Trifluoracetic acid (TFA) and standards of linolenic and linoleic acids were purchased from Sigma‐Aldrich (Prague, Czech Republic).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!