Real time pcr system

All samples for RNA analysis were prepared in biological triplicates using CCN4 KO cells plated on 6-well plates in complete growth medium for 48 h before starting the time-course experiment with a wash and replacement of medium. In groups treated with recombinant mouse CCN4 protein (rmCCN4, 1680-WS-050,R&D systems), rmCCN4 was added at a final concentration of 5.0 μg/mL. At the indicated time points, cells were lysed and total RNA was isolated using the GeneJET RNA purification kit (Thermo Fisher Scientific). 50–500 ng of each RNA was reverse-transcribed using the High Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). Real-time quantitative RT-PCR was performed on a StepOnePlus real-time PCR system with Brilliant II SYBR Green qPCR master mix (Agilent Technologies, Santa Clara, CA). Glyceraldehyde-3-phosphate dehydrogenase served as the internal control for the reactions, and the results were analyzed in R to obtain normalized gene expression values. The primer pairs for the indicated genes in this work were adopted from PrimerBank^{79 (link)} and listed in Supplemental Table 6.

Zebrafish larvae (5 dpf) were treated with PcActx peptides for 24 h prior to treatment of PTZ, which proceeded for an additional 30 min. Total RNA pools of zebrafish larvae were extracted from each group using TRIzol reagent (Life Technologies, Carlsbad, CA, United States) according to the standard protocol. cDNA was reverse-transcribed from isolated RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science, Penzberg, Germany) following the manufacturer’s protocol. RT-PCR was performed by using SYBR^® Premix Ex Taq™ II (TaKaRa, Shiga, Japan) on the Real-Time PCR System (Agilent Technologies) according to the manufacturer’s instructions. The mRNA expression was normalized to ef1a. The primer sequences used are listed in Supplementary Table S1.

Total RNA was extracted from osteoblasts and right tibia after treatments, using TRIZOL.
reagent. Reverse transcription was conducted with 0.8 μg of total RNA using the PrimeScript one-step RT-PCR kit. Real-time PCR was carried out in a Real-Time PCR System (Stratagene/Agilent Technologies, Wilmington, DE, USA) using SYBR Premix Ex TaqII. The cycling conditions were as follows: 95 °C for 2 min and 40 cycles of 95 °C for 5 sec, 60 °C for 30 sec [11 (link)]. For each rat, the gene expression was normalized with that of the housekeeping gene Gapdh and expressed as 2^-ΔΔCt. The following primers were used [13 (link), 14 (link)]: Gapdh region sense: AGACAGCCGCATCTTCTTGT and region antisense: TGATGGCAACAATGTCCACT; Osx region sense: GGCTTTTCTGTGGCAAGAGGTT and region antisense: CGCTGATGTTTGCTCAAGTGGTC; Alpl region sense: CCAGAAAGACACGTTGACTGTGG, and region antisense: TCTTGTCCGTGTCGCTCACCAT; Ocn region sense: AGCTCAACCCCAATTGTGAC and region antisense: TCCTGGAGAGTAGCCAAAGC; Opn region sense: GCTAAGCCTCAGCATCCTTG and region antisense: AAGCAAACCACTGCCAGTCT; Rage region sense: ACAGAAACCGGTGATGAAGG, and region antisense: ATTCAGCTCTGCACGTTCCCT.

cDNA for qPCR analysis was amplified using SYBR FAST (Sigma) and qPCR reactions run in the Realtime PCR System (Agilent Technologies). The transcript level for each gene was standardized based on cDNA amplification of tubulin as a reference; primer sequences are in Supplementary Table 1.

Total RNA was isolated either from Arabidopsis seeds using the RNeasy PowerPlant Kit or from seedlings using RNeasy Plant Mini Kit (QIAGEN) according to the manufacturer’s instructions. DNA in RNA samples was removed with DNase I (Thermo Fisher Scientific) and RNA was reverse-transcribed into cDNA using SuperScript II Reverse Transcriptase (Invitrogen). Quantitative PCR was performed in 96-well blocks with Brilliant II QPCR Master Mix with ROX (Agilent, #600806) on the AriaMx Real-Time PCR system. Gene expression was normalized using internal control GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT (GAPC) (At3g04120) [56 (link)]. RT-PCR was performed with Taq DNA Polymerase (NEB, #M0273) on a thermal cycler. Analysis of EXPA9 were subjected to amplication for 26 and 30 cycles, and analysis of GAPC was followed by 26 cycles.