Following digestion, 10× Genomics 3′ mRNA single-cell method was used. Approximately 7000 cells were loaded onto the Chromium10x Genomics platform (10x Genomics, CA, USA) to capture single cells, following the manufacturer’s protocol. Generation of gel beads in emulsion (GEMs) (10x Genomics, CA, EEU), barcoding and GEM-reverse transcription was performed using the Chromium Single Cell 3′ and Chromium Single Cell V(D)J Reagent Kits (10× Genomics, CA, EEU) (user guide, no. CG000086) according to manufacturer’s instructions. Full-length, barcoded cDNA was amplified by PCR to generate enough mass for library construction (Nextera® PCR primers) (Illumina, CA, USA). Sequencing of the libraries was performed on HiSeq2500 (Illumina, CA, USA).
Nextera pcr primers
Manufactured by Illumina
Sourced in United States, Ecuador
The Nextera PCR primers are a set of DNA amplification primers used in the Nextera library preparation workflow. They are designed to add sequencing adapters to DNA fragments, enabling their subsequent amplification and sequencing. The primers facilitate the attachment of sequencing adapters to DNA samples, preparing them for next-generation sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Hotstartaq master mix, by Qiagen (2 mentions)
Hiseq 2500, by Illumina (1 mentions)
E gel, by Thermo Fisher Scientific (1 mentions)
Spriselect, by Beckman Coulter (1 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
Fragment analyzer, by Agilent Technologies (1 mentions)
Transposase reaction mix, by Illumina (1 mentions)
Minelute pcr kit, by Qiagen (1 mentions)
Hiseq 2000 system, by Illumina (1 mentions)
Agilent bioanalyzer, by Agilent Technologies (1 mentions)
Minelute kit, by Illumina (1 mentions)
Pcr cleanup kit, by Qiagen (1 mentions)
Nextera index kit, by Illumina (1 mentions)
Axygen pcr cleanup kit, by Corning (1 mentions)
Quantus, by Promega (1 mentions)
H3k27ac, by Cell Signaling Technology (1 mentions)
Protein a and g dynabeads, by Thermo Fisher Scientific (1 mentions)
Usingkapa hifi hotstart readymix, by Roche (1 mentions)
Phospho rpb1 ctd, by Cell Signaling Technology (1 mentions)
Ampure xp spri beads, by Beckman Coulter (1 mentions)
8 protocols using nextera pcr primers
1
Single-cell mRNA sequencing using 10x Genomics
2
Illumina-based 16S rRNA sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were amplified for sequencing variable regions 1 to 2 (V1‐V2) at RTL Genomics (Lubbock, TX) in process consisting of two steps. The forward primer was constructed with the Illumina i5 sequencing. The reverse primer was constructed with the Illumina i7 sequencing primer. The laboratory performed amplifications with HotStar Taq Master Mix (Qiagen Inc) in reactions on ABI Veriti thermal cycler (Applied Biosytems, Carlsbad, CA). First stage amplification products were added to a second polymerase chain reaction (Nextera PCR primers; Illumina, Inc, San Diego, CA) based on qualitatively determined concentrations. EGel (Life Technologies, Grand Island, NY) were used to visualize amplification products. They were pooled equimolar and selected in two rounds using SPRIselect (Beckman Coulter, Indianapolis, IN). Size selected pools were then run on a Fragment Analyzer (Advanced Analytical, Ankeny, IA) to assess the size distribution, quantified using the Qubit 2.0 fluorometer (Life Technologies), and loaded on an Illumina MiSeq (Illumina, Inc) and sequenced. Sequence data were processed for denoising and chimera checking using a research and testing pipeline that is described together with details about used primers in http://www.researchandtesting.com/docs/Data_Analysis_Methodology.pdf .
3
ATAC-seq on Sorted Mouse Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATAC-seq was performed as described20 (link). Nuclei were prepared from sorted CD4SP, NKT, CLP and ILCP cells (10,000–50,000 for each ATAC-seq) and resuspended in the transposase reaction mix (FC-121-1030; Illumina). The transposition reaction was carried out at 37 °C water bath for 30 min. Then the samples were purified using a Qiagen PCR MinElute kit (28006; Qiagen). Following purification, library fragments were amplified using Nextera PCR Primers (FC-121-1011; Illumina) and NEBnext PCR master mix (0541; New England Lab) for a total of 10–12 cycles. The libraries were then purified using a Qiagen PCR MinElute kit and size selected in the 150–650 bp range. The size-selected libraries were quantified using the Agilent Bioanalyzer and by qPCR using the KAPA Library Quantification Kit. Libraries were sequenced on the Illumina Hiseq2000 system to generate 30–50 million reads. ATAC-seq raw reads of 50 bp were aligned to the mm10 mouse genome using bowtie allowing for two mismatches. The bedgraphs of ChIP-seq were generated using hypergeometric optimization of motif enrichment (HOMER), where the total number of aligned reads was normalized to 10 million. For each cell type, two or three biological replicates were performed.
4
ATAC-seq Analysis of T Cell Subsets
5
Second-Stage PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Products from the first stage amplification were added to a second PCR, based on qualitatively determined concentrations. Primers for the second PCR were designed based on the Illumina Nextera PCR primers and were as follows: Forward - AATGATACGGCGACCACCGAGATCTACAC[i5index]TCGTCGGCAGCGTC and Reverse - CAAGCAGAAGACGGCATACGAGAT[i7index]GTCTCGTGGGCTCGG. The thermal cycling protocol for this second stage amplification was the same as the first but limited to 10 cycles.
6
Illumina Nextera PCR-based Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the sequencing, the method described by Hoggard et al., 2018 [38 (link)] was followed. A purification step was conducted for the initial PCR reaction using an Axygen PCR cleanup kit (Axygen), and then the quality was verified with 1% Thermo Fischer Scientific Massachusetts, U.S. agarose gel electrophoresis. The purified solution was diluted; then, it was used in a range of 50 to 100-fold as a new template for a second PCR under similar conditions to the first PCR, except for using 10 cycles as recommended by Al-Sadi and Kazerooni, 2018 [39 (link)]. For this PCR round, the Illumina Nextera PCR primers described in Table 3 were used, which were followed by quantification with a Quantus® by Promega (Promega, Quito, Ecuador)). Amplicons were pooled and submitted for sequencing using an Illumina MiSeq (Illumina, Inc., San Diego, CA, USA).
7
ChIP-seq Protocol for Histone Modifications and Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-seq was performed as previously described (60 (link)). Briefly, chromatin samples prepared from appropriate numbers of
fixed cells (2 × 105 for H3K27ac and
1 × 107 for CTCF, SMC1 and Pol II)
were sonicated and subsequently immunoprecipitated with individual antibodies
recognizing CTCF (Cell Signaling Technology), SMC1 (Bethyl lab), Phospho-Rpb1
CTD (Cell Signaling Technology), and H3K27ac (Abcam). Antibody-chromatin
complexes were captured with protein A and G Dynabeads (Thermo Fisher
Scientific) and washed with low salt wash buffer, high salt wash
buffer, and LiCl wash buffer. Chromatin-antibody immobilized on magnetic
beads were then subjected to tagmentation. Eluted DNA was purified using SPRI
Ampure XP beads (Beckman Coulter) and amplified for 8–12 cycles using
KAPA HiFi HotStart Ready mix (KAPA biosystems) and Nextera PCR primers
(Illumina). Libraries were purified using dual (0.65–0.25×) SPRI
Ampure XP beads (Beckman Coulter) and paired-end sequenced (100 bp) on the
Illumina HiSeq2500 platform.
fixed cells (2 × 105 for H3K27ac and
1 × 107 for CTCF, SMC1 and Pol II)
were sonicated and subsequently immunoprecipitated with individual antibodies
recognizing CTCF (Cell Signaling Technology), SMC1 (Bethyl lab), Phospho-Rpb1
CTD (Cell Signaling Technology), and H3K27ac (Abcam). Antibody-chromatin
complexes were captured with protein A and G Dynabeads (Thermo Fisher
Scientific) and washed with low salt wash buffer, high salt wash
buffer, and LiCl wash buffer. Chromatin-antibody immobilized on magnetic
beads were then subjected to tagmentation. Eluted DNA was purified using SPRI
Ampure XP beads (Beckman Coulter) and amplified for 8–12 cycles using
KAPA HiFi HotStart Ready mix (KAPA biosystems) and Nextera PCR primers
(Illumina). Libraries were purified using dual (0.65–0.25×) SPRI
Ampure XP beads (Beckman Coulter) and paired-end sequenced (100 bp) on the
Illumina HiSeq2500 platform.
8
Fungal ITS Amplicon Sequencing by Illumina MiSeq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 17 DNA samples were subjected to Illumina MiSeq analysis (MISeq ITS1 assay; 10 K). Firstly, samples were amplified using the forward primer constructed from Illumina i5 sequencing primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) and the ITS1F primer (CTTGGTCATTTAGAGGAAGTAA)58 (link) and the reverse primer constructed from Illumina i7 sequencing primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) and ITS2aR primer (GCTGCGTTCTTCATCGATGC)52 (link),59 . The PCR reaction mixture consisted of DNA, 1 µl of each 5 µM primer and Qiagen HotStar Taq master mix (Qiagen Inc, Valencia, California). The reaction conditions included denaturation at 95 °C for 5 min, followed by 25 cycles of denaturation at 94 °C for 30 sec, annealing at 54 °C for 40 sec, and extension at 72 °C for 1 min (final for 10 min). Then a second PCR was conducted using the Illumina Nextera PCR primers and the same conditions, except for doing using 10 cycles52 (link).
The amplified products were pooled and the size selection of each pool was done in two rounds. This was followed by quantification using the Quibit 2.0 fluorometer (Life Technologies) followed by loading on an Illumina MiSeq (Illumina, Inc. San Diego, California)60 (link).
The amplified products were pooled and the size selection of each pool was done in two rounds. This was followed by quantification using the Quibit 2.0 fluorometer (Life Technologies) followed by loading on an Illumina MiSeq (Illumina, Inc. San Diego, California)60 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!