Transcript first strand cdna synthesis supermix

Manufactured by Roche

Sourced in Switzerland

The Transcript First-strand cDNA Synthesis SuperMix is a reagent used for the reverse transcription of RNA into complementary DNA (cDNA). It provides a streamlined workflow for the conversion of RNA to cDNA for downstream applications such as PCR, qPCR, or other molecular biology techniques.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (4 mentions) Lightcycler 96, by Roche (3 mentions) Ultrasybr mixture, by CWBIO (3 mentions) Sybr green reagent, by Takara Bio (1 mentions) Trizol reagent, by Takara Bio (1 mentions) Abi quantstudio 6 flex system, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (1 mentions)

5 protocols using transcript first strand cdna synthesis supermix

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was harvested using Trizol reagent (Takara, Japan), and reverse transcription (RT) was performed using Transcript First-strand cDNA Synthesis SuperMix (Roche, Switzerland). The primers used in this study were designed and synthesized by Tsingke Company (Beijing, China) (shown in Supplementary Table S4). The quantitative real-time PCR (qRT-PCR) experiments were performed using SYBR-Green reagents (Takara Bio Inc., Shiga, Japan). GAPDH was used as an internal control. Fold change obtained from Ct values using 2^−ΔΔCt methodology was converted into logarithmic base 2 for statistical analysis. P values < 0.05 were considered statistically significant. Each sample was run in triplicate, and the control group was set as 1.

Zhang M., Peng Y., Yang Z., Zhang H., Xu C., Liu L., Zhao Q., Wu J., Wang H, & Liu J. (2022). DAB2IP down-regulates HSP90AA1 to inhibit the malignant biological behaviors of colorectal cancer. BMC Cancer, 22, 561.

+ Open protocol

+ Expand

RNA Extraction and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted using TRIzol reagent (Invitrogen) and reverse transcribed to cDNA using Transcript First‐strand cDNA Synthesis Super Mix (Roche) according to the manufacturer’s instructions. Quantitative PCR was carried out with UltraSYBR mixture (Cwbio) on Roche LightCycler 96 according to standard PCR conditions. Primer sequences are listed in Table S1.

Li H., Zhou Y., Wang M., Wang H., Zhang Y., Peng R., Zhang R., Zhang M., Zhang M., Qiu P., Liu L., Zhao Q, & Liu J. (2021). DOC‐2/DAB2 interactive protein destabilizes c‐Myc to impair the growth and self‐renewal of colon tumor‐repopulating cells. Cancer Science, 112(11), 4593-4603.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of either 3D colon TRCs or 2D conventional cells was extracted using TRIzol reagent according to the supplier’s instructions (Invitrogen, Carlsbad, CA, USA). Reverse transcription (RT) was performed using Transcript First-strand cDNA Synthesis Super Mix (Roche, Switzerland). Real-time PCR was conducted with SYBR^® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa, Japan) on ABI QuantStudio™ 6 Flex System (USA). Data were analyzed with the comparative CT method for relative gene-expression quantification against GAPDH. The primer sequences are provided in Table S1.

Zhang M., Xu C., Wang H.Z., Peng Y.N., Li H.O., Zhou Y.J., Liu S., Wang F., Liu L., Chang Y., Zhao Q, & Liu J. (2019). Soft fibrin matrix downregulates DAB2IP to promote Nanog-dependent growth of colon tumor-repopulating cells. Cell Death & Disease, 10(3), 151.

+ Open protocol

+ Expand

Validation of Stemness and Hub Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Both of the conventional stemness genes and hub gene expression was further validated at the mRNA level using quantitative RT-PCR (qRT-PCR). Total RNA of cells was extracted using TRIzol reagent according to the supplier's instructions (Invitrogen, USA). Reverse transcription was performed using Transcript First-strand cDNA Synthesis SuperMix (Roche, USA). qRT-PCR was conducted with Ultra SYBR mixture (Cwbio, China) on Roche LightCycler 96 according to standard PCR condition. The primer sequences are provided as follows (human): CD44, CTGCCGCTTTGCAGGTGTA (forward) and CATTGTGGGCAAGGTGC-TATT (reverse); SOX2, TACAGCATGTCCTACTCGCAG (forward) and GAGGAAGAGGTAAC-CACAGGG (antisense); NANOG, CTCCAACATCCTGAACCTCAGC (forward) and CGTCACACCATTGCTATTCTTCG (reverse); and BUB1, GCTCTGTCAGCAGACTTCCTTC (forward) and GCTCTGTCA-GCAGACTTCCTTC (reverse).

Zhang Y., Zhang R., Zeng L., Wang H., Peng R., Zhang M., Zhang H., Yang Z., Gao L., Wang M, & Liu J. (2022). Identification and Validation of a Potential Stemness-Associated Biomarker in Hepatocellular Carcinoma. Stem Cells International, 2022, 1534593.

+ Open protocol

+ Expand

Quantitative PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted using TRIzol reagent (Invitrogen) and reverse transcribed to cDNA using Transcript First-strand cDNA Synthesis Super Mix (Roche) according to the manufacturer's instructions.
Quantitative PCR was carried out using an UltraSYBR mixture (Cwbio) on a Roche LightCycler 96 according to standard PCR conditions. All the primers were:
RIG-I-F: 5'-CTGGACCCTACCTACATCCTG-3', RIG-I-R: 5'-GGCATCCAAAAAGCCACGG-3'; GAPDH-F: 5'-GTCTCCTCTGACTTCAACAGCG-3', GAPDH-R: 5'-ACCACCCTGTTGCTGTAGCCAA-3'; p21-F: 5'-GCGACTGTGATGCGCTAATG-3', p21-R: 5'-GTGGTAGAAATCTGTCATGCTGG-3'.

Wang M., Zhang Y., Gao L., Zhang H., Yang Z., Liu J., Shan W., Zeng L., Zhang R., Li Y, & Liu J. (2023). RIG-I promotes cell proliferation in esophageal squamous cell carcinoma by facilitating p21 degradation. Medical oncology (Northwood, London, England), 40(10).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!