Applied biosystems 3500 genetic analyzer instrument

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Applied Biosystems 3500 Genetic Analyzer is a capillary electrophoresis instrument designed for genetic analysis. It utilizes fluorescence-based detection to perform DNA sequencing and fragment analysis.

Automatically generated - may contain errors

Lab products found in correlation

Chromas 2, by Technelysium (3 mentions) Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (3 mentions) Gel purification kit, by Macherey-Nagel (3 mentions) Sensifast cdna synthesis kit, by Meridian Bioscience (1 mentions)

Spelling variants of this product

3500 Genetic Analyzer (469 citations) Applied Biosystems (14 citations)

3 protocols using applied biosystems 3500 genetic analyzer instrument

KRAS Gene Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was amplified with Phusion High-Fidelity DNA Polymerase (Thermo Fisher, Waltham, MA, United States) with primers for KRAS (annealing temperature 65°C): CCCAGGTGCGGGAGAGA and AGGCATCATCAACACCCTGT. The PCR product was isolated from 2% agarose gel, purified by the Gel Purification Kit (Macherey-Nagel, Bethlehem, PA, United States), and sequenced with the forward and reverse primers with an Applied Biosystems 3500 Genetic Analyzer instrument (Life Technologies, Carlsbad, CA, United States). Data were analyzed by the Chromas 2.6 software (Technelysium Pty Ltd., South Brisbane, QLD, Australia). The results for mutational hotspots (codon 12,13, and 61) are shown in Supplementary Table 1.

Sándor G.O., Soós A.Á., Lörincz P., Rojkó L., Harkó T., Bogyó L., Tölgyes T., Bursics A., Buzás E.I., Moldvay J, & Wiener Z. (2021). Wnt Activity and Cell Proliferation Are Coupled to Extracellular Vesicle Release in Multiple Organoid Models. Frontiers in Cell and Developmental Biology, 9, 670825.

+ Open protocol

+ Expand

Amplification and Sequencing of p53 and KRAS

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was amplified with Phusion High Fidelity DNA Polymerase (Thermo Fisher) with the following primers: p53: TGAAGCTCCCAGAATGCCAG and CTTCAGGTGGCTGGAGTGAG (65 °C), KRAS: CCCAGGTGCGGGAGAGA and AGGCATCATCAACACCCTGT (65 °C). The DNA was then isolated from 2% agarose gel, purified by the Gel Purification Kit (Macherey–Nagel) and sequenced by the forward primers with Applied Biosystems 3500 Genetic Analyzer instrument (Life Technologies). Data were analyzed by the Chromas 2.6 software (Technelysium Pty Ltd).

Szvicsek Z., Oszvald Á., Szabó L., Sándor G.O., Kelemen A., Soós A.Á., Pálóczi K., Harsányi L., Tölgyes T., Dede K., Bursics A., Buzás E.I., Zeöld A, & Wiener Z. (2019). Extracellular vesicle release from intestinal organoids is modulated by Apc mutation and other colorectal cancer progression factors. Cellular and Molecular Life Sciences, 76(12), 2463-2476.

+ Open protocol

+ Expand

Targeted gene sequencing in organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from organoids was reverse transcribed with the SensiFAST™ cDNA Synthesis Kit (Bioline) and cDNA was amplified with Phusion High Fidelity DNA Polymerase (Thermo Fisher), using the following primers: TP53: TGAAGCTCCCAGAATGCCAG and CTTCAGGTGGCTGGAGTGAG (65 °C), TP53 (DNA binding domain): CCCTGCCCTCAACAAGATGT and CTCAAAGCTGTTCCGTCCCA; KRAS: CCCAGGTGCGGGAGAGA and AACAGTCTGCATGGAGCAGG (65 °C). PCR products were then isolated from 2% gel, purified by the Gel Purification Kit (Macherey–Nagel) and sequenced by the forward primers with an Applied Biosystems 3500 Genetic Analyzer instrument (Life Technologies). Results were analyzed by Chromas 2.6 software (Technelysium Pty Ltd).

Zeöld A., Sándor G.O., Kiss A., Soós A.Á., Tölgyes T., Bursics A., Szűcs Á., Harsányi L., Kittel Á., Gézsi A., Buzás E.I, & Wiener Z. (2020). Shared extracellular vesicle miRNA profiles of matched ductal pancreatic adenocarcinoma organoids and blood plasma samples show the power of organoid technology. Cellular and Molecular Life Sciences, 78(6), 3005-3020.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!