pNL3.1 (#N1031, Promega) was selected as vector and pGL4.53 (#E5011, Promega) as control. Mutant and Wildtype fragment DNAs were inserted into pNL3.1 vector by Quick Ligation Protocol (M2200, New England Biolabs) using NheI-HF (R3131S, New England Biolabs) and HindII-HF (R3104S, New England Biolabs) according to manufacturer instructions (see Supplementary Table S10 for fragment sequences). Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions. Transfection was done by ViaFectTM Transfection Reagent (E4981, Promega) according to manufacturer instructions with medium to final volume ratio of 4:1. Cells were assay after 24 hours using Nano-Glo Dual-Luciferase Reporter Assay System (N1610, Promega) according to instructions with CentroXS3 LB960 (Berthold Technology) and measurement time of 1 second for both ONE-Glo and NanoDLR.
Purelink hipure plasmid kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PureLink™ HiPure Plasmid kit is a lab equipment product designed for the rapid and efficient purification of plasmid DNA from bacterial cultures. It utilizes a silica-based membrane technology to isolate high-quality plasmid DNA suitable for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Nhei hf, by New England Biolabs (1 mentions)
Quick ligation protocol, by New England Biolabs (1 mentions)
Viafecttm transfection reagent, by Promega (1 mentions)
Nano glo dual luciferase reporter assay system, by Promega (1 mentions)
Lr clonase 2, by Thermo Fisher Scientific (1 mentions)
Nucleospin plasmid kit, by Macherey-Nagel (1 mentions)
Phusion dna polymerase, by New England Biolabs (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin solution, by Thermo Fisher Scientific (1 mentions)
X tremegene hp, by Roche (1 mentions)
5 protocols using purelink hipure plasmid kit
1
Plasmid Cloning and Dual-Luciferase Assay
2
GFP-mouse vinculin electrotransfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GFP-mouse vinculin full length (889), a gift from Alpha Yap (Addgene plasmid # 67935; http://n2t.net/addgene:67935 ; RRID: Addgene_67935), was used for electrotransfection in this study. DNA isolation was achieved with plasmid purification kits (PureLink™ HiPure Plasmid Kits, Thermo, Waltham, MA, USA).
3
Cloning and Mutagenesis of lincNMR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gateway entry vectors were obtained from the DKFZ plasmids and clone repository. LincNMR-001 was amplified using the primers listed in Supplementary Data 10 . Gateway LR reaction was performed with 50–150 ng of entry vector using LR Clonase II (Thermo, 11791020) as per the manufacturer’s instructions into the gateway destination vector pFRT-Flag/HA. Mach1 cells were used for transformation. Mini-Prep was performed using the NucleoSpin® Plasmid kit (Macherey & Nagel, 740588.250). Midi-Prep was done using the PureLink™ HiPure Plasmid kit (Invitrogen, K210004). Services from Eurofins genomics/GATC were used for sequencing with CMV.for CGCAAATGGGCGGTAGGCGTG and BGH.rev TAGAAGGCACAGTCGAGG primers. Finally, cells were transfected with respective plasmid and empty vector pFRT-Flag-HA-ΔCmR-ΔccdB as a control plasmid. Overexpression was confirmed by western blot using anti-Flag-M2 or anti-HA antibody (Supplementary Data 5 ).
Mutagenesis of the predicted high-confidence YBX1-binding sites (RBPmap) in the lincNMR transcript was performed using Phusion DNA polymerase as per supplier’s instructions (NEB, M0530S). Primers used for performing PCR are listed in Supplementary Data10 .
Mutagenesis of the predicted high-confidence YBX1-binding sites (RBPmap) in the lincNMR transcript was performed using Phusion DNA polymerase as per supplier’s instructions (NEB, M0530S). Primers used for performing PCR are listed in Supplementary Data
4
Overexpression of DYNLRB2 in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549, a lung cancer cell line was purchased from the Shanghai Institute of Cell Biology (Shanghai, China). Cells were cultured in Dulbecco’s modified Eagle’s medium buffer which was purchase from Invitrogen (Carlsbad, CA, USA) with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin-streptomycin solution (Invitrogen, Carlsbad, CA, USA). The cells were cultured in an incubator with 5% CO2 at 37 °C. When cell density reached 80%, cells were generated. We prepared transfected A549 cells with DYNLRB2 overexpression, according to the manufacturer’s protocols (GenSript, Piscataway, New Jersey, USA). A549 cells at 90–95% confluence were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with the plasmids pIRES2-ZsGreen1-homo-DYNLRB2 and plasmids pIRES2-ZsGreen1. All plasmid DNA was extracted using an Invitrogen Purelink HiPure Plasmid Kit (Invitrogen, Carlsbad, CA, USA). A549 cells were transfected with the plasmid using X-tremeGENE HP (Roche Diagnostics, Shanghai, China) and continuously cultured for 48 h.
5
Plasmid Production for Human IL-10
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2.1. Production of plasmid encoding human IL-10 ( phIL-10) phIL-10 (Origene, USA) is the plasmid pCMV6-XL5 in which the ORF cDNA sequence encoding for human interleukin 10 has been inserted. This plasmid was amplified by using a one shot BL21(DE3) pLysS kit (Invitrogen, Life Technologies), extracted by using a PureLink HiPure Plasmid kit (Invitrogen, Life Technologies), and finally stored in Tris-EDTA buffer at -20 °C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!