Sephadex g50 resin

Manufactured by Merck Group

Sourced in United States

Sephadex G50 resin is a size-exclusion chromatography medium used for the separation and purification of biomolecules. It is composed of cross-linked dextran beads and has a molecular weight fractionation range of 1,000 to 30,000 daltons. The resin is designed to facilitate the separation of small molecules from larger biomolecules.

Automatically generated - may contain errors

Lab products found in correlation

9 protocols using sephadex g50 resin

Optimized Purification of Apo-musMT3

Check if the same lab product or an alternative is used in the 5 most similar protocols

A lyophilized sample of Zn₄musMT3 was dissolved in Arsaturated deionized water and incubated with 50 mM DTT for 30 min at RT. The solution was acidified to pH 2 with 1 M HCl and separated from the released metal ions by SEC [XK 16/20 column (GE Healthcare) self-packed with Sephadex G50 resin (Sigma-Aldrich)] in 10 mM HCl. The eluted apo-musMT3 fraction was saturated with Ar, lyophilized, and kept at − 80°C for further experiments.
For the preparation of the apo-peptides a further optimised protocol was used: the lyophilized peptides were re-suspended in 10 mM HCl, incubated for 10 min at RT with 30 mM tris(2-carboxyethyl)phosphine (TCEP) and applied to a Superdex Peptide 10/300 GL SEC column (GE Health-Care) equilibrated with 10 mM HCl under anaerobic conditions (anaerobic chamber). A single symmetrical peak with increased absorption at 220 nm was collected and immediately used for further experiments.

Cabral A.C., Jakovleska J., Deb A., Penner-Hahn J.E., Pecoraro V.L, & Freisinger E. (2017). Further insights into the metal ion binding abilities and the metalation pathway of a plant metallothionein from Musa acuminata. Journal of biological inorganic chemistry : JBIC : a publication of the Society of Biological Inorganic Chemistry, 23(1), 91-107.

+ Open protocol

+ Expand

Glycogen Purification and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After reaction with glycogen synthase, the glycogen underwent two rounds of ethanol precipitation, as described above except that the reaction was diluted two-fold initially and dissolved in two times the reaction volume after the first precipitation. The glycogen was finally dissolved in 150-160 μl of 10 mM Tris-HCl pH 7.5. A portion (70 μl) was subjected to gel filtration on a spin column (Promega) containing ~1 ml of packed Sephadex G50 resin (Sigma) which had been equilibrated with 10 mM Tris-HCl pH 7.5 and extensively washed with the same buffer. Immediately prior to loading the samples, excess buffer was removed by centrifugation (1,000 x g for 1 min at 16°C). Sample (70 μl) was applied to the spin column, the column centrifuged (1,000 x g for 1 min at 16°C), and the flow-through collected. The gel filtered glycogen and an equivalent unfiltered aliquot of 70 μl were dried in a Speed Vac, dissolved in 25 μl of 10 mM Tris-HCl pH 7.5 and aliquots (20 μl) were made 1X in SDS loading buffer and subjected to SDS-PAGE. From quantitation of the ¹⁴C-labeled glycogen, recovery after gel filtration was ~95%.

Contreras C.J., Segvich D.M., Mahalingan K., Chikwana V.M., Kirley T.L., Hurley T.D., DePaoli-Roach A.A, & Roach P.J. (2016). INCORPORATION OF PHOSPHATE INTO GLYCOGEN BY GLYCOGEN SYNTHASE. Archives of biochemistry and biophysics, 597, 21-29.

+ Open protocol

+ Expand

SARS-CoV-2 Viral Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protocol for SARS-CoV-2 amplification and sequencing is detailed elsewhere [9 ]. Briefly, viral RNA was reverse-transcribed and amplified using the kit One-Step Invitrogen (SuperScript One-Step for long templates RT-PCR; Foster City, CA) and 2 different primers (5’-3’); 38F (-GTC AGT GTG TTA ATC TTA CAA CCA G-) as the forward, and 1191R (-TGC ATA GAC ATT AGT AAA GCA GAG A-) as the reverse, (the given position refers to the Wuhan strain of SARS-CoV-2). For each PCR reaction, positive and negative controls were used to ensure the effectiveness of the reaction and the absence of cross-contamination, respectively. Amplification results were revealed after agarose-gel electrophoresis and positive results were kept for the sequencing process. PCR products were then purified through the ExoSAP-IT kit (Applied Biosystems, Lithuania). Sequencing was performed with four different overlapping primers: 38F (-GTC AGT GTG TTA ATC TTA CAA CCA G-), 514F (-TCT CAG CCT TTT CTT ATG GAC CT-), 655R (-CCT GAG GGA GAT CAC GCA CTA-) and 1191R (-TGC ATA GAC ATT AGT AAA GCA GAG A-). The sequencing product was purified by gel filtration chromatography using Sephadex G-50 resin (Sigma-Aldrich) to eliminate excess primers, unincorporated dideoxynucleotides (ddNTPs) and salts. Capillary electrophoresis was performed on Applied Biosystems 3500 genetic analyzer (Applied Biosystems, Tokyo, Japan).

Fokam J., Ngoufack Jagni Semengue E., Gouissi Anguechia D.H., Etame N.K., Takou D., Mandeng N., Kengni Ngueko M.A., Beloumou Angong G., Djupsa Ndjeyep S., Chenwi Ambe C., Nka A.D., Molimbou E., Mundo Nayang A.R., Moko Fotso L.G., Tambe Ayuk Ngwese D., Tueguem P.P., Tommo Tchouaket C.M., Ka’e A.C., Fainguem N., Abega Abega C., Halle-Ekane E.G., Esso L., Etoundi Mballa A.G., Shang J., Ndongmo C.B., Cappelli G., Kifle Tessema S., Z-K Bissek A.C., Colizzi V., Ndjolo A., Perno C.F, & Ndembi N. (2024). XBB.1, BQ1.1 and atypical BA.4.6/XBB.1 recombinants predominate current SARS-CoV-2 Wavelets with flu-like symptoms in Cameroon: A snapshot from genomic surveillance. PLOS Global Public Health, 4(5), e0003153.

+ Open protocol

+ Expand

PCR Product Sequencing and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR products were purified with the PCR Cleanup KIT (Abbott, Wiesbaden, Germany) and then sequenced on both strands using the BigDye® Terminator Cycle Sequencing Kit v.3.1 (Applied Biosystems). The reaction mixture for the sequencing reaction contained 4 μl ABI PRISM Big Dye Terminator (Applied Biosystem), 3.8 μl water, 4 μl BigDye® TerminatorBuffer 5X1 (Applied Biosystems), 3.2 μl primer (1 pmol) and 5 μl of purified cDNA (40 ng), for a total volume of 20 μl. The sequencing conditions were: one cycle at 96°C for 3 min and 25 cycles (96°C for 30 s, 50°C for 10 s, 60°C for 4 min). Sequencing primers were the same of PCR reactions (see Table 2). The sequence products were purified by gel filtration chromatography using Sephadex G-50 resin (Sigma-Aldrich, Missouri, United States), in order to eliminate excess primers and/or unincorporated dideoxynucleotides (dNTPs), and then separated on an automated sequencer (ABI PRISM-3130 Genetic Analyzer, Applied Biosystems).

Berno G., Zaccarelli M., Gori C., Tempestilli M., Antinori A., Perno C.F., Pucillo L.P, & D’Arrigo R. (2014). Analysis of single-nucleotide polymorphisms (SNPs) in human CYP3A4 and CYP3A5 genes: potential implications for the metabolism of HIV drugs. BMC Medical Genetics, 15, 76.

+ Open protocol

+ Expand

Sanger Sequencing of Bacterial Amplicons

Check if the same lab product or an alternative is used in the 5 most similar protocols

spa and MLST amplicons were purified using the DNA Clean and Concentrator kit (Zymo Research, Irvine, California, USA) following the manufacturer’s instructions with a final elution volume of 30 µl. Both forward and reverse strands were sequenced. Each reaction contained 4 µl of sterile distilled water, 2 µl of 5X Big Dye buffer (Applied Biosystems, Foster City, California, USA), 1 µl (4 µM) of the PCR primer, 1 µl of Big Dye terminator mix (Applied Biosystems, Foster City, California, USA) and 4 µl of amplicon DNA. Cycle sequencing was performed on an ABI 9700 thermocycler with cycling conditions set as: 94 °C for 5 min followed by 30 cycles of 94 °C for 15 s, 55 °C for 30 s and 68 °C for 2.5 min with a final extension of 68 °C for 3 min. Sequencing fragments were purified using Sephadex G50 resin (Sigma-Aldrich, St Louis, Missouri, USA) before loading on the Applied Biosystems 3500 Genetic Analyzer.

Nyasinga J., Kyany’a C., Okoth R., Oundo V., Matano D., Wacira S., Sang W., Musembi S, & Musila L. (2019). A six-member SNP assay on the iPlex MassARRAY platform provides a rapid and affordable alternative for typing major African Staphylococcus aureus types. Access Microbiology, 1(3), e000018.

+ Open protocol

+ Expand

Liposomal Calcein Encapsulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

5mg total lipid with a ratio of 4:2:1 PC:PE:PS (Avanti polar lipids) in chloroform was dried under vacuum to give a solvent-free film. This was hydrated in 1ml of Calcein buffer (50mM calcein, 100mM NaCl, 10mM Na₂HPO₄ 2mM KH₂PO₄) and freeze-thawed three times. The lipid suspension was then extruded 10 times through a 1μm polycarbonate membrane filter (Whatman) using a Mini Extruder (Avanti polar lipids). Un-encapsulated calcein was removed from the extruded suspension by size exclusion chromatography using sephadex G-50 resin (Sigma Aldrich), while PBS pH 7.5 (liposome buffer) was used as the aqueous phase buffer. Liposomes were stored at 4 °C and used within 1 week of creation.

Zhang X., Patel A., Celma C.C., Yu X., Roy P, & Zhou Z.H. (2015). Atomic model of a non-enveloped virus reveals pH sensors for a coordinated process of cell entry. Nature structural & molecular biology, 23(1), 74-80.

+ Open protocol

+ Expand

Radiolabeling of Zirconium-89 Immunoconjugates

Check if the same lab product or an alternative is used in the 5 most similar protocols

In brief,
an aliquot containing approximately 17 MBq of zirconium-89 in oxalic
acid (1 M, PerkinElmer) was adjusted to pH 7 by the addition of sodium
carbonate (1 M). The resulting solution was added to a solution of
DFO-anti-MT1-MMP-IRDye800CW or DFO-IgG-IRDye800CW in PBS (95–101
μL, 2.3–2.4 mg/mL). The reaction mixture was incubated
at room temperature for 1 h at 450 rpm, and the radiolabeling efficiency
was determined by radio-iTLC using EDTA (50 mM, pH 5.5) as the mobile
phase. RICs were purified from the crude reaction mixture by size
exclusion chromatography using Sephadex-G50 resin (Sigma-Aldrich),
eluting with 100 μL fractions of PBS (pH 7.4) as the eluent.
The radiochemical purity of isolated RICs was determined by radio-iTLC
as previously described.

Pringle T.A., Chan C.D., Luli S., Blair H.J., Rankin K.S, & Knight J.C. (2022). Synthesis and In Vivo Evaluation of a Site-specifically Labeled Radioimmunoconjugate for Dual-Modal (PET/NIRF) Imaging of MT1-MMP in Sarcomas. Bioconjugate Chemistry, 33(8), 1564-1573.

+ Open protocol

+ Expand

Sequencing of ORF Region

Check if the same lab product or an alternative is used in the 5 most similar protocols

The amplified products from the ORF region were completely sequenced in the sense and antisense orientations using an automated sequencer (ABI 3500 Genetic Analyzer) with four different overlapping sequence-specific primers: 38F, 514F(TCTCAGCCTTTTCTTATGGACCT), 655R (CCTGAGGGAGATCACGCACTA) and 1191F. The reaction mixture for the sequencing reaction contained 1.5 μl ABI PRISM Big Dye Terminator V3.1, 6.5 μl big dye diluent (from the kit), 4.8 μl DNAse/RNAse-free water, 3.2 μl primer (1 μM stock) and 2 μl of purified cDNA. The sequencing conditions were as follows: 35 cycles (96 °C, 10 s; 55 °C, 10 s; 60 °C, 4 min); 1 cycle of 4 °C for 30 min. The sequencing product was purified by gel filtration chromatography using Sephadex G-50 resin (Sigma-Aldrich,USA) in order to eliminate excess primers, unincorporated dideoxynucleotides (ddNTPs), and salts. Capillary electrophoresis was performed using an Applied Biosystems 3500 genetic analyzer (Applied Biosystems, Japan).

Fokam J., Gouissi Anguechia D.H., Takou D., Jagni Semengue E.N., Chenwi C., Beloumou G., Djupsa S., Nka A.D., Togna Pabo W.L., Abba A., Ka'e A.C., Kengni A., Etame N.K., Moko L.G., Molimbou E., Nayang Mundo R.A., Tommo M., Fainguem N., Fotsing L.M., Colagrossi L., Alteri C., Ngono D., Otshudiema J.O., Ndongmo C., Boum Y., Etoundi G.M., Halle E.G., Eben-Moussi E., Montesano C., Marcelin A.G., Colizzi V., Perno C.F., Ndjolo A, & Ndembi N. (2024). SARS-CoV-2 genomic surveillance and reliability of PCR single point mutation assay (SNPsig® SARS-CoV-2 EscapePLEX CE) for the rapid detection of variants of concern in Cameroon. Heliyon, 10(7), e29243.

+ Open protocol

+ Expand

Liposomal Calcein Encapsulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!