Sybr green

Manufactured by Integrated DNA Technologies

SYBR Green is a fluorescent dye used in molecular biology for nucleic acid detection and quantification. It binds to double-stranded DNA, emitting a fluorescent signal that can be detected and measured. SYBR Green is commonly used in real-time PCR and other DNA-based assays.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using sybr green

Gene Expression Analysis via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated according to the manufacturer’s instructions (QIAGEN miRNeasy), and genomic DNA removed using the DNA-free DNA removal kit (Ambion). mRNA-encoding cDNA was synthesized using the SuperScript III Reverse Transcriptase kit (Invitrogen), while miRNA- encoding cDNA was synthesized using the Taqman MicroRNA Reverse Transcription kit (Applied Biosystems). SYBR Green quantitative PCR was performed using the Bioline SensiFAST SYBR Lo-Rox kit and Taqman quantitative PCR was performed using the Bioline SensiFAST Lo-Rox kit. Both SYBR Green and Taqman amplification primers (Integrated DNA Technologies, or Applied Biosystems) are listed in Supplementary file 2.

Wells A.C., Daniels K.A., Angelou C.C., Fagerberg E., Burnside A.S., Markstein M., Alfandari D., Welsh R.M., Pobezinskaya E.L, & Pobezinsky L.A. (2017). Modulation of let-7 miRNAs controls the differentiation of effector CD8 T cells. eLife, 6, e26398.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from cultured cells, hind limb, or spleen was isolated and reverse transcribed into cDNA as we have described, and target genes amplified using an Eppendorf Realplex4 Mastercycler^{27 (link),29 (link)}. Multiple mRNAs (Ct values) were quantitated simultaneously by the Eppendorf software. Gene expression in IL-19-stimulated cultured human mvEC was performed using the human angiogenesis RT² Profiler PCR array from SABiosciences as described by the manufacturer. Primer pairs were purchased from Integrated DNA Technologies, (Coralville, IA), SYBR green used for detection. The following primer pairs were used: Mouse GAPDH: F: GCAAGGACACTGAGCAAGAG, R: GGGTCTGGGATGGAAATTGT, Mouse Arginase 1:F: AAGAATGGAAGAGTCAGTGTGG, R: GGGAGTGTTGATGTCAGTGTG Mouse Arginase 2: F: CAGAAGGTGATGGAACAGACA, R: GCCAGTTTAGGGTCAAATGC Mouse Ym1: F: AGAGTGCTGATCTCAATGTGG, R: GGGCACCAATTCCAGTCTTAG Mouse KLF4: F: ACTTGTGACTATGCAGGCTG, R: ACAGTGGTAAGGTTTCTCGC Mouse VEGF-A: F: GGCAGCTTGAGTTAAACGAAC, R: TGGTGACATGGTTAATCGGTC Mouse IL-12p40: F: GTGAAGCACCAAATTACTCCG, R: AGAGACGCCATTCCACATG Human GAPDH: F: CGAGAGTCAGCCGCATCTT, R: CCCCATGGTGTCTGAGCG, Human IL-8: F: CCAGGAAGAAACCACCGGA, R: GAAATCAGGAAGGCTGCCAAG Human HGF: F: ATCAAATGTCAGCCCTGGAG, R:CCTCTGGATTGCTTGTGAAAC Human CXCL1: F: TGCTCCTGCTCCTGGTAG, R: CTTCTGGTCAGTTGGATTTGTC

Richards J., Gabunia K., Kelemen S.E., Kako F., Choi E.T, & Autieri M.V. (2014). Interleukin-19 increases Angiogenesis in ischemic hind limbs by Direct Effects on both Endothelial Cells and Macrophage Polarization. Journal of molecular and cellular cardiology, 79, 21-31.

+ Open protocol

+ Expand

Quantifying lincRNA and Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated RNA using Quick-RNA kit (Zymo Research; R1054) was reverse-transcribed with high-capacity cDNA kit according to the manufacturer’s instructions (Thermo Fisher; 43–688-13). Sybr Green quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) with human specific SIMALR and NTN1 primers (Integrated DNA Technologies) was used to validate lincRNA and gene expression. SIMALR primers: F- ACAATTAGCGTGTGGGGAGT, R- TTGGAGGTCTCTCGGTAGGT. NTN1: F- TGCAAGCCCTTCCACTACG, R- TGTTGTGGCGACAGTTGAGG. HIF1α: F- AACATAAAGTCTGCAACATAGAAG, R- TTTGATGGGTAAGGAATGGG. Probes were normalized to ubiquitin C (UBC) or Actin Beta (ACTB) as internal controls. Applied Biosystems Fast Real Time PCR System was used for amplification. ΔΔCt measured fold changes ^{35 (link)}, expressed as mean +/− standard error of the mean (SEM) comparing SIMALR knockdown and overexpression to control samples. Copies per μg of SIMALR RNA were determined using standard curves of SIMALR isoforms. To create standard curves, qPCR was performed with SIMALR isoforms specific primers and ten-fold serial dilutions of the pcDNA3.1 SIMALR templates of all three isoforms. The calculated Ct values were plotted against log copy number to generate standard curve ^{36 (link)}.

Cynn E., Li D., O’Reilly M.E., Wang Y., Bashore A.C., Jha A., Foulkes A., Zhang H., Winter H., Maegdefessel L., Yan H., Li M., Ross L., Xue C, & Reilly M.P. (2022). Human Macrophage Long Intergenic Non-coding RNA, SIMALR, Suppresses Inflammatory Macrophage Apoptosis via Netrin 1. Arteriosclerosis, thrombosis, and vascular biology, 43(2), 286-299.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the Total RNA Purification Kit and genomic DNA removed using the RNase-Free DNase I Kit (Norgen Biotek, Cat# 37500 and 25710, respectively). cDNA was synthesized using the SensiFast cDNA Synthesis Kit (Thomas Scientific, Cat# C755H66). SYBR Green quantitative PCR was performed using the SensiFAST SYBR Lo-Rox kit (Thomas Scientific, Cat# C755H95) and Taqman quantitative PCR was performed using the SensiFAST Probe Lo-Rox kit (Thomas Scientific, Cat# C755H88). Both SYBR Green and Taqman amplification primers (Integrated DNA Technologies, or Applied Biosystems) are listed in Supplementary data 5.

Wells A.C., Hioki K.A., Angelou C.C., Lynch A.C., Liang X., Ryan D.J., Thesmar I., Zhanybekova S., Zuklys S., Ullom J., Cheong A., Mager J., Hollander G.A., Pobezinskaya E.L, & Pobezinsky L.A. (2023). Let-7 enhances murine anti-tumor CD8 T cell responses by promoting memory and antagonizing terminal differentiation. Nature Communications, 14, 5585.

+ Open protocol

+ Expand

SARS-CoV-2 RNA Detection qPCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were homogenized in an Omni Bead ruptor in TRIzol, and then the RNA was extracted from 300 μL of each sample using the Direct-zol RNA miniprep kit (Zymo Research); 2 μL of isolated RNA from each sample was then converted to cDNA using the RevertAID first-strand cDNA synthesis kit (Thermo Fisher Scientific) in a 20-μL total reaction volume. For qPCR for SARS2 Rdrp, 20-μL reactions were prepared using 2 μL cDNA, 1 μL 10 mM Rdrp Forward primer (10006860; Integrated DNA Technologies), 1 μL Rdrp Reverse primer (10006881; Integrated DNA Technologies), and 10 μL 2x SYBR Green (Thermo Fisher Scientific). The reactions were then run on a 7500 Fast Dx Real-Time PCR Instrument (4357362R; Applied Biosystems). For qPCR for murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 20-μL reactions were prepared using 2 μL cDNA, 1 μL of a 20x murine GAPDH primer (MM.pt.39a.1; Integrated DNA Technologies), and 10 μL 2x SYBR Green. The reactions were then run on a QuantStudio 5 Real-Time PCR Instrument (A28133; Applied Biosystems).

McGrath M.E., Xue Y., Dillen C., Oldfield L., Assad-Garcia N., Zaveri J., Singh N., Baracco L., Taylor L.J., Vashee S, & Frieman M.B. (2022). SARS-CoV-2 variant spike and accessory gene mutations alter pathogenesis. Proceedings of the National Academy of Sciences of the United States of America, 119(37), e2204717119.

+ Open protocol

+ Expand

Extraction and Quantification of SARS-CoV-2 RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were homogenized in an Omni Bead ruptor in TRIzol and then the RNA was extracted from 300μL of each sample using the Direct-zol RNA miniprep kit (Zymo Research, Irvine, CA). 2μL of isolated RNA from each sample was then converted to cDNA using the RevertAID first strand cDNA synthesis kit (Thermo Fisher, Waltham, MA) in a 20μL volume. For qPCR for SARS2 Rdrp, 20μL reactions were prepared using 2μL cDNA, 1μL of 10mM Rdrp Forward primer (10006860, Integrated DNA Technologies, Coralville, IA), 1μL of Rdrp Reverse primer (10006881, Integrated DNA Technologies, Coralville, IA), and 10μL of 2x SYBR Green (Thermo Fisher, Waltham, MA). The reactions were then run on a 7500 Fast Dx Real-Time PCR Instrument (4357362R, Applied Biosystems, Waltham, MA). For qPCR for murine GAPDH, 20μL reactions were prepared using 2μL cDNA, 1μL of a 20x murine GAPDH primer (MM.pt.39a.1, Integrated DNA Technologies, Coralville, IA), and 10μL of 2x SYBR Green. The reactions were then run on a QuantStudio 5 Real-Time PCR Instrument (A28133, Applied Biosystems, Waltham, MA).

McGrath M.E., Xue Y., Dillen C., Oldfield L., Assad-Garcia N., Zaveri J., Singh N., Baracco L., Taylor L., Vashee S, & Frieman M. (2022). SARS-CoV-2 Variant Spike and accessory gene mutations alter pathogenesis. bioRxiv.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!