G box chemi xx6 system

Double stranded (ds)DNA for EMSAs was generated by annealing complementary primers (VACV72 FWD: ATCCATCAGAAAGAGGTTTAATATTTTTGTGAGACCATCGAAGAGA GAAAGAGATAAAACTTTTTTACGACT, REV: AGTCGTAAAAAAGTTTTATCTCTTTC TCTCTTCGATGGTCTCACAAAAATATTAAACCTCTTTCTGATGGAT). Primers were diluted to 20 μg mL⁻¹ in Buffer A (40 mM HEPES pH 7.4, 160 mM KCl, glycerol (5% v/v), triton x100 (0.1% v/v), 1 mM EDTA, 5 mM DTT) and heated to 95°C for 10 min. Annealed dsDNA was allowed to cool and further diluted to 4 μg mL⁻¹. Recombinant human AIM2-GST (200 nM) was mixed with dsDNA (200 ng mL⁻¹) in Buffer A and incubated at room temperature (RT) for 5 min before the addition of 4-sulfonic calix[4]arene, 4-sulfonic calix[6]arene, 4-sulfonic calix[8]arene or 4-tert-buyl calix[6]arene (1:20 of stock concentration to indicated concentration, made up in Buffer A). Reaction was incubated at RT for 30 min, before the addition of 5X DNA loading buffer and resolution by electrophoresis using 6% Tris-borate-EDTA (TBE) gels. dsDNA was stained by incubation with SYBR safe in TBE for 10 min before visualisation using UV transillumination on a G:Box Chemi XX6 system (Syngene).

Initial tests to verify the reactivity in Western blotting of each MAb with the homologous partially purified strain were performed as previously described (21 (link)). Later, the cross-reactivity of one representative MAb (4A3) with all FMDV serotypes was confirmed as follows.
Virus lysates from IBRS-2 cells infected with different FMDV serotypes were denatured and reduced by heating at 95°C for 5 min in Red loading buffer and dithiothreitol (DTT) (NEB). The samples were resolved through the use of 12% Tris-glycine gels and transferred to nitrocellulose membranes (GE Healthcare) (0.45 μM) using a Mini-Protean Tetra cell (Bio-Rad). Membranes were placed in blocking buffer (20 mM Tris and 150 mM NaCl [pH 7.6] with 0.1% [vol/vol] Tween 20 [TBS-T] and 1% [wt/vol] bovine serum albumin [BSA] [Melford]) for 1 h at room temperature (RT) followed by incubation with hybridoma supernatants (MAbs) and anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody (Dako) (1/5,000 in blocking buffer) in sequence for 1 h at RT. The incubations were separated by cycles of three washings with TBS-T. West Pico chemiluminescent substrate (Thermo Fisher Scientific, United Kingdom) was added to the membrane, and exposures of the membrane were collected and visualized using a G:Box Chemi XX6 system (Syngene).

Whole-cell extracts were prepared using RIPA buffer (50 mM Tris, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM Na3VO4, 5 mM NaF, and 1% cocktail protease inhibitors; Sigma). The protein concentration was measured by the Pierce™ BCA Protein Assay Kit (Thermo Scientific). Equal amounts of protein (40 µg/sample) were separated by electrophoresis in a 12% denatured polyacrylamide gel and blotted onto nitrocellulose membranes (Biorad). The membranes were blocked for 1 h in 5% low-fat milk in 1× PBS with 0.1% Tween20 (PBST) at room temperature. The filters were then incubated overnight at +4 °C with the following primary antibodies: PPARɣ (2443, Cell Signaling, diluted 1:1000) and α-Tubulin (3873, Cell Signaling, diluted 1:1000). The membranes were washed 3 times for 10 min with PBST and then incubated with HRP-conjugated anti-rabbit or anti-mouse antibodies (Biolegend) for 2 h at room temperature. The membranes were then washed for 3 times for 10 min in PBST, and proteins were visualized by the ECL chemiluminescence method. The immunoreactive bands of proteins were acquired using GBOX Chemi XX6 system (Syngene).