Briefly, 1 μg of total RNA was reversed transcription into cDNA by PrimeScript RT reagent kit. Real-time PCR was executed by the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA) using TB Green Premix Ex Taq II kit following the manufacturer's protocol. Specific primers for PCR amplification were synthesized by the Sangon Biotech (Shanghai, China) and the used sequences are listed in Table S1 . The gene expression levels were normalized to GAPDH and analyzed using the comparative cycle threshold (F = 2−ΔΔCt) method.
Tb green premix ex taq 2 kit
Manufactured by Bio-Rad
Sourced in United States
The TB Green Premix Ex Taq II kit is a reagent kit designed for real-time PCR amplification and detection of DNA targets. It contains a premixed solution of DNA polymerase, buffer, dNTPs, and the TB Green dye for fluorescent detection of amplified products.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
Cfx96 rt pcr machine, by Bio-Rad (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions)
Real time pcr system c1000 thermal cycler, by Bio-Rad (1 mentions)
Nanodrop ultramicro spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rnaiso plus kit, by Takara Bio (1 mentions)
C1000 touch thermal cycle, by Bio-Rad (1 mentions)
9 protocols using tb green premix ex taq 2 kit
1
Quantitative Gene Expression Analysis by RT-qPCR
2
Quantitative analysis of intestinal gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from jejunum, ileum and colon tissues (without content) and the quantitative real-time PCR (qRT-PCR) were performed as previously reported (Huang et al., 2014 (link)). Briefly, total RNA was extracted using Trizol reagent, and the quality and nucleic acid concentration were measured using spectrophotometer (NanoDrop 2000; Thermo Scientific, Shanghai, China). Reverse transcription was processed according to the manufacturer’s instructions (two-step). Quantitative real-time PCR was performed using the Bio-Rad CFX-96 system and TB Green Premix Ex Taq II kit. Gene expressions were normalized related to β-Actin, with primer sequences for SYBR Green probes of NGB obtained from Primer Bank: β-actin (No. 6671509a1), IL-1β (No.118130747c1) and TNF-α (No.133892368c2).
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from samples was extracted and the synthesized first-strand cDNA (complementary DNA) was reverse-transcribed. Quantitative real-time PCR (qPCR) was performed using a TB Green Premix Ex Taq II Kit with a CFX96 RT-PCR machine (Bio-Rad, Hercules, State of California, United States of America). The amplification programs utilized in this analysis were as follows: 98 °C for 45 s, followed by 34 cycles of 98 °C for 15 s and 60 °C for 45 s. Each sample was analyzed in triplicate to ensure the accuracy of the data. Atactin2 was employed as a housekeeping gene, and the primers involved in qPCR analysis are listed in Table S3 .
4
Quantifying Mitochondrial DNA Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular DNA was separated using a MiniBEST universal genomic DNA extraction kit. The mtDNA content was quantified by estimating the relative levels of mtDNA‐ND1 to SLCO2B1 and mtDNA‐ND5 to SERPINA1 using a TB Green Premix Ex Taq II kit in a CFX96 real‐time PCR detection system (Bio‐Rad). The amplification primers were obtained from a Human Mitochondrial DNA Monitoring Primer Set and the mtDNA copy number was calculated as (2(SLCO2B1‐ND1) + 2(SERPINA1‐ND5))/2.
5
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol was applied for total RNA extraction. Removal of the contaminating genomic DNA and cDNA synthesis was implemented with PrimeScript RT Reagent kit with gDNA Eraser (Takara RR047A, Japan). CFX96 Real-Time PCR detection system (Bio-Rad, Singapore) was utilized to fulfill real-time quantitative reverse transcription PCR employing TB Green Premix Ex Taq II kit. The internal reference of mRNA qPCR was glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Significant differences were validated utilizing independent-sample t-test, with P < 0.05 deeming statistical significance. All primer sequences employed in the experiment are in the Table 2 .
Primer.
| Gene name | Primer-F | Primer-R |
|---|---|---|
| SPP1 | CTCCATTGACTCGAACGACTC | CAGGTCTGCGAAACTTCTTAGAT |
| MMP3 | CTGGACTCCGACACTCTGGA | CAGGAAAGGTTCTGAAGTGACC |
| WNT5A | ATTCTTGGTGGTCGCTAGGTA | CGCCTTCTCCGATGTACTGC |
| TIMP1 | CTTCTGCAATTCCGACCTCGT | ACGCTGGTATAAGGTGGTCTG |
| ADAM8 | GAGGGTGAGCTACGTCCTTG | CAGCCGTATAGGTCTCTGTGT |
| CTSD | TGCTCAAGAACTACATGGACGC | CGAAGACGACTGTGAAGCACT |
| GAPDH | GTGGCAAAGTGGAGATTGTTG | AGTCTTCTGGGTGGCAGTGAT |
| C5AR1 | TCCTTCAATTATACCACCCCTGA | ACGCAGCGTGTTAGAAGTTTTAT |
6
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol Reagent followed by treatment with chloroform and precipitation with 2-propanol. The total RNA pellet was then washed with 75% ethanol and resuspended in water. The RNA was subjected to reverse transcription using a PrimeScript RT-PCR Kit, and quantitative real-time PCR analysis (CFX96, Bio-Rad, Hercules, CA, USA) of the genes of interest was conducted using a TB Green Premix Ex Taq II kit. Relative gene expression was calculated using the 2−ΔΔCt method. The data were normalized to the expression level of β-actin in percentage, and control in each group was normalized to 100%. Primers are shown in Supplementary Materials (Accession gene IDs: 15368, 18104, 14629, 14630, 12359, 20655, 20656, 11461) (Table S1 ).
7
Quantification of mRNA and tsRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, RNA was extracted from subcutaneous fat tissue using TRIzol reagent (TaKaRa, Dalian, China). Reverse transcription was performed using the PrimeScript RT Master Mix kit (TaKaRa, Dalian, China) for mRNA, and the Mir-X miRNA First-Strand Synthesis Kit (TaKaRa, Dalian, China) for tsRNA. Real-time PCR of tsRNA and mRNA was performed using the TB Green Premix Ex Taq II Kit in a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad, Richmond, CA, USA). The expression levels of mRNA and tsRNA were normalized with β-actin and U6 as controls, respectively. The relative expression levels of mRNA and tsRNA were calculated using the 2−ΔΔCt method [36 (link)]. All primer sequences are listed in Supplementary Table S1 .
8
Mammary Gland RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the mammary gland of dams by using the Total RNA Kit. The purity and concentration of RNA were measured by Nanodrop ultramicro spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized from 1 μg of RNA using the PrimeScriptTM RT reagent Kit. The mRNA expression was performed using a TB Green® Premix Ex Taq™ II kit and Bio-Rad C1000 Thermal Cycler Real-Time PCR System (Bio-Rad, Hercules, CA, USA). Relative mRNA expression was measured by relative quantification with β-actin as the internal reference. The primer sequences of all the targets are shown in Table S2 . Relative gene expression was calculated according to the 2−ΔΔCt method.
9
Quantifying Fly Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure mRNA levels of indicated fly genes, ~7 flies were collected for homogenate preparation. For homogenate preparation, a sterile zirconia bead was added into the sample with 200 μL pre-cooled RNAiso, then the sample was crashed by vibrating the zirconia bead with frequency of 30Hz for 3 min in a Retsch MM400 grinding mixer. Homogenates of fly for each treatment were then extracted by RNAiso Plus kit (TAKARA). RNA (1 μg) was reverse transcribed using PrimeScript™ RT reagent kit (TAKARA). qPCR analyses were preformed using the TB Green premix Ex Taq™ II kit on a BIO-RAD C1000 Touch™ Thermal Cycle. And the expression levels of target genes were normalize to rp49 (data are presented as ΔCT, 2^(Ctrp49 - Cttarget genes)). Primers used were in Supplementary Table 2
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!