Alexa fluor 647 labeled phalloidin

Latrunculin A (Cayman Chemicals 10010630) was dissolved in DMSO as a 2 mM stock solution and stored at −20 °C until use. Jasplakinolide (Millipore-Sigma, 420107) was reconstituted in DMSO and stored at −20 °C for up to 3 months. Cells were incubated in the LatA for 60 min at 2 μM and in the Jpk for 120 min at 0.1 or 0.2 μM. Dosing concentration and duration to induce actin depolymerization were based on reported conditions for other cell types^{62 (link),93 ,94 (link)} and verified qualitatively by phalloidin staining and fluorescence microscopy of adherent cells. The DMSO control cells were exposed to 0.1% DMSO in cell culture media for the same time as the drug-treated cells. Cells were fixed with 3.7% paraformaldehyde in 1× PBS (10 min at room temperature), and permeabilized with 0.1% Triton X-100 (for 5 min at room temperature and stained with Alexa Fluor 647-labeled phalloidin (20 min at room temperature, ThermoFisher Scientific, A22287).
Cells were imaged by epi-fluorescence with an Olympus IX70 inverted microscope controlled with Metamorph (Molecular Dynamics). Images were captured with an Andor iXon+ EMCCD camera (DU-885K-C00-#VP) with an Olympus LCPlanFl 40X (0.6 NA) objective, a mercury arc lamp (X-cite exacte, Lumen Dynamics), and a Chroma 49009 ET filter. Exposure time was 800 ms and pixel binning was 1×.

Mature osteoclasts were fixed in ice-cold methanol or PBS containing 4% paraformaldehyde and stained with anti-vATPase subunit e1 (1:1000, PA5-29899, Thermo Fisher), anti-Cathepsin K (1:100, ab37259, Abcam), anti-Vinculin (1:100, V9264, Sigma), or control antibody (1:100, 5415 S, Cell Signaling), followed by fluorescently labeled secondary antibodies, following manufacturer’s instructions (Fisher). Some cells were also stained with Alexa Fluor 647-labeled Phalloidin (Thermo Fisher), following manufacturer’s instructions. The nuclei were stained with 1 µg/ml of Hoechst 33342 (Fisher) in PBS. Images were taken on an EVOS FL Auto (Thermo Fisher) and analyzed using the accompanying software. Because of intense TRAP staining in Elmo1^−/− osteoclast cultures, we counted the number of osteoclasts after cathepsin K staining by immunofluorescence. Cathepsin K-positive cells with three or more nuclei were counted using Image J. RosaYFP and Phalloidin stained osteoclast cultures were imaged on a Zeiss Imager Z2 with Apotome and analyzed using the AxioVision 4.8 software (Zeiss).

All chemicals were purchased from Sigma-Aldrich (St. Louis, MO) or Fisher Scientific (Nepean, ON, Canada) unless otherwise indicated. The PAK1 inhibitor IPA-3 was purchased from EMD Chemicals (Gibbstown, NJ). GABA was purchased from Abcam (Toronto, ON). Antibodies to the following proteins were obtained from the indicated suppliers: Anti-TKS5 (SH3 #1) EMD Millipore 09-403, Myosin Light Chain 2 ABM Y021157, Myosin Light Chain 2 antibody [EPR3741] Abcam ab92721, p-MYL9 Antibody (Thr 18/Ser 19)-R Santa Cruz Biotechnology sc-12896-R, Phospho-PAK1 (Thr423)/PAK2 (Thr402) Antibody Cell Signaling Technology 2601S, Anti-PAK1 antibody Abcam ab40852, Cofilin (phospho S3) antibody Abcam ab12866, Anti-Cofilin antibody (ab42824) Abcam ab42824. All secondary antibodies and Alexa Fluor 647–labeled phalloidin were purchased from Invitrogen (Burlington, Canada). PAK1 shRNA construct (CCAAGAAAGAGCTGATTATT) and control plasmid pLKO.1 was kindly provided by Dr. Jason Moffat and the Ontario Institute for Cancer Research (OICR) Genomics Facility. The pEGFR-GFP plasmid was obtained from Addgene (Plasmid #32751). The MLC2 T18A,S18A plasmid was obtained from Addgene (Plasmid # 35681).