Differentiation media

Manufactured by Thermo Fisher Scientific

Sourced in United States

Differentiation media is a type of cell culture medium used to promote the differentiation of cells, such as stem cells or progenitor cells, into specialized cell types. This media provides the necessary nutrients, growth factors, and environmental cues to support the differentiation process. The core function of differentiation media is to facilitate the transition of cells from a less specialized state to a more specialized state, enabling the study of cellular development and the production of specific cell types for various applications.

Automatically generated - may contain errors

Lab products found in correlation

Oil red o, by Merck Group (2 mentions) Ab92511, by Abcam (1 mentions) Ab81289, by Abcam (1 mentions) Fast blue, by Merck Group (1 mentions) Alizarin red staining, by Merck Group (1 mentions) Envision hrp antimouse, by Agilent Technologies (1 mentions)

Close spelling variants of this product

StemPro Chondrogenic Differentiation media StemPro Adipogenesis differentiation media Osteogenic differentiation media StemPro Osteogenesis Differentiation Media Kit Adipogenic differentiation media StemPro differentiation media Chondrogenic differentiation media StemPro™ Osteogenesis Differentiation media

4 protocols using differentiation media

Multilineage Differentiation of hADSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

hADSCs were seeded in 12-well culture plates at a density of
2,500 cells/cm² and expanded until cells reached 90% confluency.
For adipogenic, osteogenic, and chondrogenic differentiation, hADSCs were
stimulated for 28, 21 and 14 days in differentiation media (GIBCO, Grand Island,
NY, USA) according to manufacturer’s instructions. Adipogenic, osteogenic, and
chondrogenic differentiation were assessed by staining for Oil red O, Alizarin
Red S and Safranin O, respectively.
Immunophenotype of hADSCs was carried out using flow cytometry for the following
markers: SSEA-4 (MAB4304, Merck-Millipore, Darmstadt, Germany), CD34 (ab81289,
Abcam), CD90 (#561970, BD Pharmingen, San Diego, CA, USA), CD105 (MCA1557,
Bio-rad, Hercules, CA, USA) and HLA-DR (ab92511, Abcam). Samples were analyzed
using a FACS Calibur-S System (BD Immunocytometry Systems, San Jose, CA, USA)
and the obtained data were analyzed with FlowJo software (FlowJo, version
7.6.1).

Yoon E.J., Seong H.R., Kyung J., Kim D., Park S., Choi E.K., Kim Y.B, & Park D. (2021). Stamina-Enhancing Effects of Human Adipose-Derived Stem Cells. Cell Transplantation, 30, 09636897211035409.

+ Open protocol

+ Expand

Quantifying MSC Differentiation Potential

Check if the same lab product or an alternative is used in the 5 most similar protocols

MSCs were seeded in 12-well culture plates at a density of 2500 cells/cm² and expanded until cells reached 80–90% confluency. For osteogenic and adipogenic differentiation and immuno-staining experiments, cells were stimulated for 14 days in differentiation media (GIBCO) according to manufacturer’s instructions. In the experiments intended for quantification of the differentiation potential, MSC were cultured in differentiation media for 7 days. Osteogenic and adipogenic differentiation were assessed by staining for alkaline phosphatase (Fast Blue, Sigma) and for the presence of lipid droplets (Oil red O, Sigma)14 (link). Quantitative real time polymerase chain reaction (qRT-PCR) was utilized for quantification of osteogenic and adipogenic differentiation efficacy in the various alternative media formulations. To quantify the effect of alternative media on the adipogenic and osteogenic differentiation, the expression of adiponectin, PPAR-γ, and alkanine phosphatase was assessed using the following sets of primers: PPAR-γ; Forward: GAGCCCAAGTTTGAGTTTGC, Reverse: TCAATGGGCTTCACATTCAG, Adiponectin; Forward: CCTGGTGAGAAGGGTGAGAA, Reverse: CTCCTTTCCTGCCTTGGATT, Alkaline phosphatase: Forward: GACATCGCCTACCAGCTCAT, Reverse: TGGCTTTCTCGTCACTCTCA.

Oikonomopoulos A., van Deen W.K., Manansala A.R., Lacey P.N., Tomakili T.A., Ziman A, & Hommes D.W. (2015). Optimization of human mesenchymal stem cell manufacturing: the effects of animal/xeno-free media. Scientific Reports, 5, 16570.

+ Open protocol

+ Expand

Multipotency Assessment of ADSCs and BM-MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To verify multipotency of ADSCs and BM-MSCs, the cells were differentiated in vitro into adipogenic, osteogenic, and chondrogenic lineages. The differentiation was induced by culture in appropriate differentiation media, according to the manufacturer’s instructions (Invitrogen, USA). Adipogenesis was measured by the accumulation of neutral lipids in fat vacuoles and stained with Oil Red O (Sigma-Aldrich). Osteogenesis was confirmed using Alizarin Red staining (Millipore, USA). Chondrogenic differentiation was evaluated by anticollagen type II immunocytochemical staining (anticollagen type II clone 6B3, dilution 1:100; Millipore and EnVision⁺/HRP antimouse; Dako, Denmark). Stained samples were analyzed using light microscopy by 2 independent pathologists.

Pokrywczynska M., Jundzill A., Warda K., Buchholz L., Rasmus M., Adamowicz J., Bodnar M., Marszalek A., Helmin-Basa A., Michalkiewicz J., Gagat M., Grzanka A., Frontczak-Baniewicz M., Gastecka A.M., Kloskowski T., Nowacki M., Ricordi C, & Drewa T. (2018). Does the Mesenchymal Stem Cell Source Influence Smooth Muscle Regeneration in Tissue-Engineered Urinary Bladders?. Cell Transplantation, 26(11), 1780-1791.

+ Open protocol

+ Expand

Tri-Lineage Differentiation of ADSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plastic adherence property of MSCs was observed by culturing in appropriate media at 37°C in the presence of 5% CO₂. The surface markers had been previously analysed by flow cytometric characterization (Lonza). Further, for characterising the multipotent property of ADSCs, tri-lineage differentiation was performed into adipogenic, osteogenic, and chondrogenic lineages. Briefly, the cells were seeded at the appropriate seeding densities, grown to 90% confluence in growth media, and then replaced by the respective differentiation media (Invitrogen) for specific durations. Undifferentiated ADSCs maintained in basal growth media served as control.
At the end of the differentiation period, lineage-specific staining was performed to visualise the differentiation and observed using bright field microscopy. Briefly, cells were fixed with 4% paraformaldehyde for 30 minutes, and rinsed with phosphate buffered saline (PBS). Following fixation, lineage-specific staining methods such as Oil Red O, alizarin red/von Kossa, and alcian blue were used for detecting adipogenic, osteogenic, and chondrogenic lineages respectively.

Visweswaran M., Schiefer L., Arfuso F., Dilley R.J., Newsholme P, & Dharmarajan A. (2015). Wnt Antagonist Secreted Frizzled-Related Protein 4 Upregulates Adipogenic Differentiation in Human Adipose Tissue-Derived Mesenchymal Stem Cells. PLoS ONE, 10(2), e0118005.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!