The largest database of trusted experimental protocols

Anti c myc tag 9e10 affinity gel

Manufactured by BioLegend
Sourced in United States

The Anti-c-Myc Tag (9E10) Affinity Gel is a bead-based resin designed for the affinity purification of c-Myc-tagged recombinant proteins from cell lysates or culture supernatants. The gel contains monoclonal antibodies specific for the c-Myc epitope tag, which allows for the selective capture and isolation of c-Myc-tagged proteins.

Automatically generated - may contain errors

4 protocols using anti c myc tag 9e10 affinity gel

1

Immunoprecipitation of MHC II and Myc-tag

Check if the same lab product or an alternative is used in the 5 most similar protocols
MutuDCs or spleen cDCs were lysed on ice in lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% v/v Triton X-100) supplemented with 10 mmN-ethylmaleimide (Sigma-Aldrich) and cOmplete Mini EDTA-free protease inhibitor cocktail (Roche). Post-nuclear supernatants were pre-cleared by incubation with uncoupled protein G-sepharose beads (Walter and Eliza Hall Institute Antibody Facility). MHC II was immunoprecipitated with anti-MHC II mAb (M5/114) coupled to protein G-sepharose beads (Walter and Eliza Hall Institute Antibody Facility), and Myc-tag was immunoprecipitated with anti-c-Myc-tag (9E10) affinity gel (BioLegend). Samples were eluted by denaturation in non-reducing sample buffer at 95 °C and analyzed by western blot analysis.
+ Open protocol
+ Expand
2

Immunoprecipitation-Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole-cell proteins were extracted from transfected HEK293T cell lines as previously described (Western blotting). A total of 3000 μg protein extract was incubated overnight at 4°C with either EGFP diluted 1:100 sc-9996 (Santa Cruz Biotechnology, Dallas, TX, USA), anti-c-Myc Tag (9E10) Affinity Gel (BioLegend, San Diego, CA, USA), or b-actin 1:100 sc-1616R (Santa Cruz Biotechnology, Dallas, TX, USA). Antigen-antibody complexes were precipitated with protein A/G-Sepharose sc-2003 (Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at 4°C and washed 3 times with cold PBSX1. Precipitated proteins were then resolved by SDS-PAGE, blotted onto nitrocellulose membranes, and reacted with the appropriate antibodies: enhanced green fluorescent protein (EGFP) diluted 1:1000 sc-9996 (Santa Cruz Biotechnology, Dallas, TX, USA), anti-MYC diluted 1:1000 9E10 (Developmental Studies Hybridoma Bank, The University of Iowa), or anti-actin dilution 1:500 sc-1616R (Santa Cruz Biotechnology, Dallas, TX, USA).
+ Open protocol
+ Expand
3

Ubiquitination Analysis of MFF and TRAF3

Check if the same lab product or an alternative is used in the 5 most similar protocols
For ubiquitination analysis, 293T cells were co-transfected with LPC-HA-Ub and pUB-TRAF3-SBP-6xHis, pUB-Myc-MFF or an empty lentiviral vector pUB-Thy1.1. At day 2 post transfection, cells were treated with 10 µM of the proteasome inhibitor MG-132 at 37°C for 4 h, and then harvested at 2 x 107 cells/condition. Total cellular proteins were lysed in 1% CHAPS Lysis Buffer (39 (link)) containing 1x Phosphatase Inhibitors (Pierce) and 1 mM NEM. The insoluble pellets were removed by centrifugation at 10,000 g for 20 minutes at 4°C. The CHAPS lysates were subsequently immunoprecipitated with the Anti-c-Myc Tag (9E10) Affinity Gel (BioLegend) or Streptavidin-Sepharose beads (Pierce). Immunoprecipitates were washed 5 times with the Wash Buffer (39 (link)) containing 1x Phosphatase Inhibitors and 1 mM NEM. Ubiquitination of the immunoprecipitated MFF or TRAF3 was analyzed by immunoblot analyses.
+ Open protocol
+ Expand
4

Immunoprecipitation of ADAR1 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole-cell proteins and RNAs were extracted from Fmrp-MYC transfected HEK293T cell lines as described above. A total of 3000 μg protein-RNA extract was incubated overnight at 4°C with either anti-c-Myc Tag (9E10) Affinity Gel (BioLegend, San Diego, CA, USA), or b-actin 1:100 sc-1616R (Santa Cruz Biotechnology, Dallas, TX, USA). Antigen-antibody complexes of b-actin were precipitated with protein A/G-Sepharose sc-2003 (Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at 4°C. Antibody-protein-RNA complexes of both samples were washed 3 times with cold PBSX1. Coprecipitated RNAs were isolated by resuspending beads in 1 ml TRIzol reagent (Zymo Research, Irvine, CA, USA) followed by ethanol precipitation. cDNA was prepared as described above. PCR amplifications were performed using the following specific primers: adar1: 5'- CGGGCAATGCCTCGC -3' and 5'- AATGGATGGGTGTAGTATCCGC -3'.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!