Superscript 3 first strand synthesis system

A total of 50–100 mg of organ samples from nasal mucosa, trachea, or lung was mechanically disrupted by cutting before 1 mL TRIzol reagent (Invitrogen, Waltham, MA, USA) was added. Samples were incubated for 5 min at room temperature, followed by homogenisation using a bead-beating tissue homogeniser. RNA was extracted using TRIzol reagent. RNA was used as a template for cDNA synthesis using the SuperScript III First-Strand Synthesis System and random hexamers (Thermo Fisher Scientific, Waltham, MA, USA). Finally, cDNA was subjected to qPCR using SYBR Green Mastermix (Thermo Fisher Scientific, Waltham, MA, USA), and primers targeting cat ACE2 (for: CAAGCACTTACAATTGTTGGAA, rev: TGAGTAATCATTAGCAACATGGAA). Cycle threshold (ct) values were normalised to total RNA. Dilution series of expression plasmids containing cat ACE2 were used as standards to calculate the amounts of genomic equivalents (GE) based on the ct values.

Total RNA was isolated from cells by using a SV total RNA isolation kit following the manufacturer’s protocol (Promega, Z3105). The respective cDNAs were synthesized by using the superscript III first strand synthesis system (Thermo Fisher Scientific). Gene expression analysis was done with RT-qPCR by using SYBR Green PCR master mix (4367659, Thermo Fisher Scientific) using oligo (dT) primers. Primers used for gene expression analysis are listed in Fig. S1.

Brains from adult zebrafish (cntn1b^−/−, caspr^−/−, mag^−/−) and 5dpf zebrafish larvae (nfascb^−/−) were snap-frozen and stored at −80 °C. For RNA isolation, samples were homogenized in RLT Buffer Plus (Qiagen) for 30 min on ice, followed by centrifugation in QIAshredder columns (Qiagen, 79654) for 2 min at maximum speed. RNA was isolated from lysates of whole brains or single larvae with the RNeasy Mini kit (Qiagen, 74104) and retrotranscribed with the SuperScript III First-Strand Synthesis system (ThermoFisher, 18080051). Quantitative real-time PCRs were performed with PowerUp SYBR Green Master Mix (ThermoFisher, A25742), using an Applied Biosystems 7500 Fast Real-Time PCR system. The following primers were used: cntn1b: 5’-TGGAAGAAATCGGCGACACA-3’ and 5’-TTCAGAAACGCAGGAGTGGT-3’, caspr: 5’-ATGGCAGACGGTTTTCCTCA-3’ and 5’-ACCTCCCACCTCCATGACTC-3’, nfascb: 5’-TAGACATCGTGACGCAGGGA-3’ and 5’-TATCCTCTCAAGAGACCTGTAATCA-3’, mag: 5’-TAGAGGAAGGCACGGGAGAC-3’ and 5’-GGGGCAGAGGGAATGATTGG-3’, Elf1a 5’-AGCAGCAGCTGAGGAGTGAT-3’ and 5’-GTGGTGGACTTTCCGGAGT-3’. Relative quantification of gene expression was performed by the ΔΔCt method.

The total RNA was extracted from a kidney slice using the Ambion RiboPure Kit (Thermo Fisher Scientific, Scoresby, Australia) and reverse transcribed into cDNA using random primers with the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific). PCR was run on the StepOne Real-Time PCR system (Thermo Fisher Scientific) using Taqman probes. The primer/probes for α-SMA, NOS2 and CD206 have been published previously [45 (link),46 (link)], and the other primer/probes were purchased from Thermo Fisher Scientific. The relative amount of mRNA was determined using the comparative Ct (ΔΔCt) method. All amplicons were normalized against GAPDH which was analysed in the same reaction as an internal control.

Complementary DNA (cDNA) was synthesized with the SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, Waltham, MA, USA) and oligo (dT)₂₀. Expression of candidate genes for RNA-Seq validation and mesenchymal marker genes was analyzed using the SYBR Green method (LightCycler 480 SYBR Green I Master, Roche, Indianapolis, IN, USA) and the LightCycler 480 II (Roche, Indianapolis, IN, USA). Primers are list in Supplementary Table S6.

The total cDNA was synthesized using SuperScript^® III First-Strand Synthesis System (Thermo Fisher, Waltham, MA, USA) with total mRNA extracted from C3A cells as template. The α1AT coding sequence with was amplified by PCR using primers with HindIII and XhoI restriction sites: α1AT F 5′-aagcttactcagtaaatggtagatc-3′ and α1AT R 5′-gtaaatggtagatc-3′. The PCR product was purified and digested with HindIII and XhoI restriction endonucleases (NEB) and inserted into pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) cut by the same endonucleases to produce a recombinant plasmid pcDNA3.1α1AT. Plasmid express GFP-tagged human GADD34 [pEGFP-C1GADD34] obtained from Dr.Shirish Shenolikar’s lab (Brown University, Providence, RI, USA). Plasmids G3BP-GFP-λN and GFP-λN obtained from Dr Reineke LC (Baylor college of Medicine, Houston, TX, USA).