Tsa cy3

Paraffin sections were deparaffinized and rehydrated, and treated with proteinase K (20 µg/ml, Invitrogen) for 10 min followed by acetylation with triethanolamine for 10 min at room temperature. After prehybridization, DIG-labeled probes (300 ng/ml) were hybridized at 65°C overnight. For the Fst in situ probe see Table S2. After washing once with 2×SSC for 20 min and four times for 20 min each with 0.2×SSC at 65°C, slides were blocked with 10% heat-inactivated sheep serum in TBS (50 mM Tris-HCl, 50 mM NaCl pH 7.5) for 1 h, and incubated with HRP-conjugated sheep anti-DIG antibody (1:1000; Roche Applied Science, 11207741910) in 1% heat-inactivated sheep serum/PBS at 4°C overnight. To detect Krt5, slides were incubated with anti-Krt5 antibody followed by secondary antibody and DAPI for counterstaining. Slides were incubated with TSA-Cy3 (PerkinElmer) for 10 min.

Slides were incubated with SYNGR3 Invitrogen antibody at 1:300 for 1 hour and were detected with ImmPress HRP anti-rabbit IgG and TSA Cy5 (SAT705A001EA). After completion of SYNGR3 staining, a second round of denaturation (10 minutes, Bond-Epitope Retrieval solution 1) was followed by incubation in either anti- pan-Cytokeratin (30 minutes, 1:1,500) or CD45 (30 minutes; ready to use) and detection with ImmPress HRP anti-rabbit IgG and TSA Cy3 (SAT704A001EA; Perkin Elmer). Following pan-Cytokeratin/CD45 staining, a third denaturation step was performed for 10 minutes in Bond-Epitope Retrieval solution 2 (pH 9.0; AR9640) followed by incubation with either anti-CD3 (1 hour, 1:200) or p16 (1 hour, 1:5) then detection with Bond Polymer (DS9455) and TSA Alexa-488 (B40953, Invitrogen).
Stained slides were dehydrated and coverslipped with either Cytoseal 60 (single DAB stains; 8310-4, Thermo Fisher Scientific) or Prolong gold (multiplex stains; P36930, Thermo Fisher Scientific). Positive and negative controls (no primary antibody) were included during staining runs. The slides were digitally scanned at 20× magnification using Aperio AT2 (Aperio Technologies) and uploaded to the Aperio eSlideManager database (Leica Biosystems Inc) at the Pathology Services Core at UNC.

FISH assays were performed to detect miR-302a in CRC tissue as previously described 18 (link). miR-302a probes, including a double digoxigenin (DIG)-labeled probe against miR-302a, were synthesized (Exiqon). An anti-digoxigenin HRP-conjugated antibody (PerkinElmer) and tyramide signal amplification (TSA) Cy3 (PerkinElmer) were used. Nuclei were stained with Hoechst 33342. Slides were mounted with Mounting Medium (Vectashield) before imaging with a Nikon ECLIPSE Ti confocal microscope. The staining intensity was assessed as previously described 19 (link).

After decapitation, the cortex from WT mice was dissected, snap-frozen in isopentane and then stored at −70 °C until being sectioned on a cryostat. Twenty micrometer-thick transversal or coronal sections were mounted on slides. Slices were treated with 4% Parafomaldeyde for 30’ and washed with saline-sodium citrate (SSC) buffer 0,5X twice for 10 min. The slices were then treated with Proteinase K solution (7 μg/μL Proteinase K, 0,5 M NaCl, 10 M Tris-HCl, pH 8.0) for 30 min and then treated with pre-Hybridization solution (50% formammide, 4X SSC, 1X Denhardt’s Solution, 2 mM EDTA, 500 μg/ml ssDNA) for 2 h at 42 °C. Digoxigenin-labeled BC1 RNA antisense was hybridized on tissue sections overnight at 53 °C and detected with the use of anti-digoxigenin–HRP conjugate (Roche) and a commercial cyanine-5 tyramide signal amplification kit (TSA-CY3; PerkinElmer). Sections were counterstained for nuclei with Hoechst (Hoechst; Life technologies). The specificity of the labeling was monitored by omitting the riboprobe or using BC1 sense RNA probe. Images were acquired using an inverted confocal microscope (Zeiss).
BC1 RNA sense and antisense digoxigenin-labeled riboprobes sequences are:
AS Probe Exiqon: Probe: /5DigN/AAAGGTTGTGTGTGCCAGTTA/3DigN/
Position in target (BC1 sense): 134–154
Sense Probe Exiqon: Probe: /5DigN/AAACAAGGTAACTGGCACACA/3DigN/
Position in target (BC1 sense): 126- 146

For immunohistochemistry, muscle samples were embedded in a mixture of tragacanth gum/OCT and flash frozen in an isopentane bath over liquid nitrogen. Muscle tissues were cut into 10 μm sections and air-dried at room temperature for 20 min followed by fixation with cold acetone for 3 min at − 20 °C. Slides were incubated in 3% hydrogen peroxide for 10 min. After blocking, slides were incubated with FGF23 antibody for human (21-6610, 1:100, Quidel) and antibody for mouse (21-6320, 1:500, Quidel) overnight at 4 °C. After washing in PBS, slides were incubated with HRP secondary antibody (Vector Laboratories) for 90 min at RT, followed by TSA Cy3 (PerkinElmer, Waltham, MA) for 30 min. Sections were incubated in Wheat Germ Agglutinin (WGA), Oregon Green 488 Conjugate (ThermoFisher), followed by Hoechst 33342 (Sigma- Aldrich, St. Louis, MO) at 1:20,000 for 5 min. Slides were imaged using a Nikon C2 confocal microscope.