Abi steponeplus

Total RNA (1000 ng) was used in the reverse transcription step to prepare the cDNA. Quantitative RT‐PCR was performed on an ABI‐Step One Plus (Thermo) using SYBR Green (4,913,850,001, Roche). Specific primer pairs for PRDM5 were as follows: forward 5′‐ACTCGATGCTGAACTGAAGGA‐3′ and reverse 5′‐GTTCTTCAGTGCACAGCGAAA‐3′. The relative expression levels of RNA were calculated by the 2^−ΔΔCt method. Each sample was tested in triplicate.

For miRNA and RNA extraction from human lung explants, 100 mg of pulmonary tissue sample was crushed with a POLYTRON® probe (PT 3 100; Kinematica, Luzern, Switzerland) in 1 ml of TRIzol® (Life Technologies, Saint-Aubin, France) (20 (link)).
miRNA and RNA were extracted from cells using a Nucleospin miRNA kit (Macherey-Nagel, Düren, Germany). For plasma and neutrophil samples, miRNA was extracted using a Nucleospin miRNA Plasma kit (Macherey-Nagel). RNA and miRNA were eluted with 30 μL of sterile RNase-free water. The concentration and quality of the RNA and miRNA were evaluated using a DS-11 Series Spectrophotometer (DeNovix, Wilmington, DE, USA) based on absorbance at 260 nm.
miR-636, miR-103, miR-16-5p, and RNU6B were reverse-transcribed with a TaqMan™ MicroRNA Assay Kit (Thermo Fisher Scientific) using 20 ng of miRNA. IL1R1, RANK, IKBKB, FAM13, IL-8, IL-6, and GAPDH were reverse-transcribed with a High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) using 1 μg of RNA. qPCR was performed using an ABI StepOnePlus™ (Thermo Fisher Scientific) and TaqMan™ technology. For relative quantification, miRNA and RNA levels were calculated using the 2^−ΔΔCT method and normalised to the expression levels of RNU6B, miR-103, miR-16-5p, and GAPDH. Each sample was assessed in triplicate.

Total RNA was isolated using the Universal Plant RNA Extraction Kit (BioTeke, Beijing, China), and reverse transcribed to cDNA with the PrimeScript™ RT reagent Kit (TaKaRa, Kyoto, Japan). The gene-specific primers of 32 CiSPLs were designed using CDS sequences and Primer 5.0 software, and all the primers are listed in Table S1. qRT-PCR was performed on ABI StepOnePlus (Thermo Fisher Scientific, Waltham, MA, USA) with SYBR Green Realtime PCR Master Mix (Thermo Fisher). Each reaction volume was 20 µL, and included 1 µL of diluted cDNA template, 0.4 µL of each gene forward and reverse primer, 10 µL of SYBR Mix, 8.2 µL of ddH2O, and 0.4 µL of ROX Reference Dye. The PCR reaction procedure was as follows: 95 °C for 30s, followed by 40 cycles at 95 °C for 5 s, 60 °C for 34 s, and the dissolution curve reaction procedure (95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s). The pecan actin gene was used as the internal reference gene (Zhang et al., 2016 (link)). The relative expression level for all CiSPL genes was calculated using the 2^−ΔΔCt method (Livak & Schmittgen, 2001 (link)). ANOVA Duncan analysis was performed for significant difference analysis using SPSS 21.0 software.

Total RNA from cultured CRC cells and sorted xenograft tumor cells was extracted using the High Pure RNA Isolation Kit (Roche Diagnostics, Indianapolis, IN, USA) and miRNeasy Micro Kit (Qiagen, Tokyo, Japan), respectively, according to the manufacture’s protocols. Complementary DNAs was prepared using ReverTra ACE (TOYOBO Life Science, Osaka, Japan) and qPCR assays were performed using SYBR Green reagents (TOYOBO Life Science) in an ABI Step One Plus thermal cycler (Thermo Fisher Scientific). The primer sequences used for qPCRs are listed in Table S1. We measured the expression of all three FBXW7 isoforms. The mRNA level of each gene was normalized to that of ACTB.

Gene expression levels were determined by real-time PCR, as previously described (Lameu et al., 2012 (link)). From the total RNA extracted of neuroblastoma cells, cDNA strands were synthetized using the cDNA Cycle Kit (Thermofisher), following manufacturer's recommendations. Real time PCR was performed in 25 μl of buffer reaction containing 1 μl of cDNA, SYBR Green Master Mix (Thermofisher), and 5 pmol of each sequence-specific primer (Table 1). Thermal cycling carried out with the ABI Step One Plus instrument (Thermofisher) consisted of a pre-incubation step for 2 min at 50°C, then denaturation for 10 min at 95°C followed by 40 cycles for denaturation for 15 s at 95°C, and annealing/extension for 1 min at 60°C. Gene expression levels of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were used for normalization of gene expression. Relative gene expression of P2X7A and P2X7B receptor isoforms were determined with the TaqMan assay as previously described (Adinolfi et al., 2010 (link)). Gene expression levels were normalized by using β2-microglobulin as endogenous control (for primer sequences see Table 1). The results were analyzed for relative quantitation among groups using the comparative 2^−ΔΔCT method (Livak and Schmittgen, 2001 (link)).