M mlv kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The M-MLV kit is a reverse transcription kit used for the conversion of RNA to complementary DNA (cDNA). It contains the Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase enzyme, which catalyzes the synthesis of single-stranded cDNA from an RNA template.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

M-MLV (292 citations)

43 protocols using m mlv kit

Quantification of Pro-Inflammatory Genes in BV-2 Microglia

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expressions of pro-inflammation genes of BV-2 microglia cells, including tumor necrosis factor-α (TNF)-α, IL-1β, and inducible nitric oxide synthase (iNOS), were detected by quantitative real-time PCR. M-MLV kit was bought from Life Technology Inc. (USA), regarding microglia RNA as template reverse transcription. into complementary DNA. The primers (Sigma, USA) used were as follows:

* TNF-α: Forward 5′-CATCTTCTCAAAATTCGAGTGACAA-3′, reverse 5′-TGGGAGTAGACAAGGTACAACCC-3′;

* IL-1β: Forward 5′-CAACCAACAAGTGATATTCTCCATG-3′, reverse 5′-GATCCACACTCTCCAGCTGCA-3′;

* iNOS: Forward 5′-CAGCTGGGCTGTACAAACCTT-3′, reverse 5′-CATTGGAAGTGAAGCGTTTCG-3′;

* GAPDH:Forward 5′-TTCACCACCATGGAGAAGGC-3′, reverse 5′- GGCATGGACTGTGGTCATGA -3′.

Tian Z., Xu L., Chen Q., Feng R., Lu H., Tan H., Kang J., Wang Y, & Yan H. (2019). Treatment of Surgical Brain Injury by Immune Tolerance Induced by Peripheral Intravenous Injection of Biotargeting Nanoparticles Loaded With Brain Antigens. Frontiers in Immunology, 10, 743.

+ Open protocol

+ Expand

Multiplex RT-qPCR for B19V mRNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from infected or transfected cells using TRIzol reagent (Invitrogen), and cDNA was synthesized using a Moloney murine leukemia virus (M-MLV) kit (Life Technologies, Carlsbad, CA). The multiplex RT-qPCR system for quantification of B19V-specific mRNAs has been described previously (37 (link)).

Wang J., Ganaie S.S., Cheng F., Xu P., Ning K., Wang X., Kleiboeker S., Cheng S, & Qiu J. (2020). RNA Binding Motif Protein RBM45 Regulates Expression of the 11-Kilodalton Protein of Parvovirus B19 through Binding to Novel Intron Splicing Enhancers. mBio, 11(2), e00192-20.

+ Open protocol

+ Expand

Pro-inflammatory Gene Expression in BV-2 Microglia

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expressions of pro-inflammation genes of BV-2 microglia cells, including tumor necrosis factor-α (TNF)-α, IL-1β, and inducible nitric oxide synthase (iNOS), were detected by quantitative real-time PCR.
M-MLV kit was bought from Life Technology Inc., (USA), regarding microglia RNA as template reverse transcription into complementary DNA. The primers (Sigma, USA) used were as follows:

TNF-α: Upstream primer 5′-CATCTTCTCAAAA TTCGAGTGACAA-3AT downstream 5′-TGGGAGTAGACAAGGTACAACCC-3G

IL-1β: Upstream primer 5′-CAACCAACAAGT GATATTCTCCATG-3AA downstream 5′-GATCCACACTCTCCAGCTGCA-3A

iNOS: Upstream primer 5′-CAGCTGGGCT GTACAAACCTT-3AG downstream 5′-CATTGGAAGTGAAGCGTTTCG-3A.

Cui Z.Q., Liu B.L., Wu Q.L., Cai Y., Fan W.J., Zhang M.C., Ding W.L., Zhang B., Kang J.M, & Yan H. (2016). Could Intrathymic Injection of Myelin Basic Protein Suppress Inflammatory Response After Co-culture of T Lymphocytes and BV-2 Microglia Cells?. Chinese Medical Journal, 129(7), 831-837.

+ Open protocol

+ Expand

Quantifying BRD and c-MYC mRNA levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA after extraction with TRIzol (Invitrogen) was titrated to 1μg/μL with a NanoDrop 2000c UV-Vis spectrophotometer (Thermo Scientific) and stored at −80°C. Complementary DNA (cDNA) was synthesized from 1μg RNA with a reverse transcriptase M-MLV Kit^® (Life Technologies) using Random Hexamer Primers (Thermo Scientific). RT-qPCR reactions (BRD2, BRD3, BRD4, c-MYC, HEXIM1, GAPDH and ABL) were performed in 25 μl from one- tenth of the cDNA volume (100 ng RNA), using a thermocycler ABI7900HT (Life Technologies) with TaqMan reagent or a StepOnePlus (Life Technologies) with SYBR Green reagent (Roche) in standard mode (1 cycle of 2 minutes at 50°C then 10 minutes at 95°C followed by 50 cycles of 15 seconds at 95°C then 1 minute at 60°C) with a supplementary melting curve step for SYBR Green assays. Primers (Eurogentec) are listed in supplementary Table 1. mRNA levels were normalized to ABL control gene.

Coudé M.M., Braun T., Berrou J., Dupont M., Bertrand S., Masse A., Raffoux E., Itzykson R., Delord M., Riveiro M.E., Herait P., Baruchel A., Dombret H, & Gardin C. (2015). BET inhibitor OTX015 targets BRD2 and BRD4 and decreases c-MYC in acute leukemia cells. Oncotarget, 6(19), 17698-17712.

+ Open protocol

+ Expand

Circadian Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNA Mini Kit (Qiagen) and a quantitative Real-Time PCR was performed according to the manufacturer's instructions (MMLV Kit, Life Technologies and Smart SYBRGreen kit, Roche Applied Science). Circadian gene expression was investigated using specific primers targeting Bmal1 and Clock genes (8) . Results were normalized using the housekeeping endogenous control actb gene (-actin). The results are expressed according to the appropriate formula: gene expression = Log (2 -ΔCt ) relative expression, with Ct (Cycle threshold), ΔCt = Ct target gene -Ct β-actin. The Cosinor analysis based on an extrapolation from measurements of a few points over 24 hours was used to evaluate the CR of the clock genes Bmal1 and Clock.

Diallo A.B., Gay L., Coiffard B., Léone M., Mezouar S., & Mège J. (2020). Daytime variation in SARS-CoV-2 infection and cytokine production.

+ Open protocol

+ Expand

Quantitative Analysis of PPV mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA was synthesized using Moloney murine leukemia virus (M-MLV) kit (28025013; ThermoFisher, Waltham, MA, USA). A Real-time system (q-PCR) was used to detect PPV interrelated mRNA, β-actin as an internal control. All primer in Table 1 were synthesized (Sangon Biotech, Shanghai, China).

Chen S., Miao B., Chen N., Chen C., Shao T., Zhang X., Chang L., Zhang X., Du Q., Huang Y, & Tong D. (2021). SYNCRIP facilitates porcine parvovirus viral DNA replication through the alternative splicing of NS1 mRNA to promote NS2 mRNA formation. Veterinary Research, 52, 73.

+ Open protocol

+ Expand

Quantitative Analysis of ESCC Transcripts

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from ESCC cells using TRIzol™ Reagent (MDBio, Taipei, Taiwan) and RNA quality was analyzed by a NanoVue Plus™ Spectrophotometer (Biochrom Ltd., Cambridge, UK). A MMLV Kit (Thermo Fisher Scientific; Waltham, MA, USA) used 1-3 (μg/μL) of total RNA to convert RNA to cDNA. The converted cDNA was amplified with primers (primers used in the qPCR assays are listed in Supplementary Table 3) using the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) [57 (link), 80 (link), 81 (link)].

Huang C.L., Achudhan D., Liu P.I., Lin Y.Y., Liu S.C., Guo J.H., Liu C.L., Wu C.Y., Wang S.W, & Tang C.H. (2023). Visfatin upregulates VEGF-C expression and lymphangiogenesis in esophageal cancer by activating MEK1/2-ERK and NF-κB signaling. Aging (Albany NY), 15(11), 4774-4793.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

5∗10⁵ cells were washed resuspend in 400 μL TRIreagent. RNA isolation was then performed according to the isolation protocol from TRIreagent supplier (SIGMA). In brief, 0.1 mL of 1-bromo-3-chloropropane per mL of TRI Reagent was added, samples were mixed by vigorous shaking, incubated for 15 min at room temperature and then centrifuged at 12’000 g for 15 min at 4°C for phase separation. The aqueous phase was then mixed with 0.5 mL of isopropanol per mL of TRI Reagent used, again centrifuged for 10 min for RNA precipitation. RNA was then washed with 70% Ethanol and finally resuspend in RNAse-free water. RNA concentration and purity was determined with a Nanodrop2000 Spectrophotometer (ThermoScientific).
For Rcan3 qPCR, reverse transcription was performed using the SIGMA MMLV kit on 1 μg RNA according to the manufacturer’s instructions. qPCR was run with TaqMan FAST Universal PCR master mix on an Applied Biosystems® Real-Time PCR System. 18S was used as a reference gene.
For miRNA17 qPCR, reverse transcription was performed using the TaqMan MicroRNA Reverse Transcription Kit (ABI) and a miRNA-specific reverse stem-loop primer according to the manufacturer’s instructions (Moltzahn et al., 2011 (link)). qPCR was run with TaqMan FAST Universal PCR master mix on an Applied Biosystems® Real-Time PCR System. SNO234 was used as a reference gene.

Dölz M., Hasiuk M., Gagnon J.D., Kornete M., Marone R., Bantug G., Kageyama R., Hess C., Ansel K.M., Seyres D., Roux J, & Jeker L.T. (2022). Forced expression of the non-coding RNA miR-17∼92 restores activation and function in CD28-deficient CD4+ T cells. iScience, 25(11), 105372.

+ Open protocol

+ Expand

Sodium Butyrate Modulates Chicken Macrophage Cytokine Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effect of sodium butyrate on the expression of inflammatory cytokine genes in chicken macrophages was performed using RT-qPCR, as described earlier (Sun and Jobin, 2014 (link)). Chicken macrophages (5 × 10⁵ cells per well) were seeded in 6-well plate and incubated at 37°C in a humidified, 5% CO₂ incubator for 48–72 h. A mid-log SE culture was inoculated on HTC cells (∼6 Log CFU/mL; multiplicity of infection 10:1) in presence or absence of SICs of sodium butyrate followed by incubation for 4 h at 37°C in a humidified, 5% CO₂ incubator. Following incubation, total RNA was isolated from chicken macrophages using TRIzol reagents (Thermo Fisher Scientific) as per manufacturer’s protocol. Complementary DNA (cDNA) was synthesized using M-MLV kit (Thermo Fisher Scientific). Messenger RNA (mRNA) expression of inflammatory mediators was determined using SYBR Green PCR Master Mix (Bio-Rad Laboratories, Inc., CA, United States) in a 384-well RT-qPCR System and normalized to endogenous control, Gapdh. The primers of each gene were designed from Primer 3 software (National Center for Biotechnology Information, Bethesda, MD) and obtained from Integrated DNA Technologies, Inc. (Coralville, IA) (Table 2).

Gupta A., Bansal M., Wagle B., Sun X., Rath N., Donoghue A, & Upadhyay A. (2020). Sodium Butyrate Reduces Salmonella Enteritidis Infection of Chicken Enterocytes and Expression of Inflammatory Host Genes in vitro. Frontiers in Microbiology, 11, 553670.

+ Open protocol

+ Expand

Sodium Butyrate Modulation of Salmonella Virulence

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effect of SIC of sodium butyrate on the expression of SE virulence genes was determined using real-time quantitative PCR (RT-qPCR) as described previously (Upadhyaya et al., 2015 (link); Sun and Jia, 2018 (link); Bansal et al., 2019 (link)). SE was cultured to mid-log phase with or without SIC of sodium butyrate in TSB at 37°C for 10 h. The total RNA was extracted using TRIzol reagents (Thermo Fisher Scientific) as per manufacturer’s protocol. Complementary DNA (cDNA) was synthesized using M-MLV kit (Thermo Fisher Scientific). Messenger RNA (mRNA) expression of SE genes was determined using SYBR Green PCR Master mix (Bio-Rad Laboratories, Inc., CA, United States) in a 384-well real-time PCR System (Model 7500 Fast Step One Plus system-Applied Biosystems, Thermo Fisher Scientific) and normalized to endogenous control, 16S rRNA. The primers used in this study (Upadhyaya et al., 2015 (link)) were obtained from Integrated DNA Technologies, Inc. (Coralville, IA) (Table 1). After the thresholds (Ct) were obtained, the relative gene expression was calculated using 2^–Δ^ΔCt method according to these reports.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!