Sequalprep long pcr kit

We employed a long-range PCR (SequalPrep Long PCR Kit, Life Technologies, Grand Island, NY, USA) method to amplify the complete mitochondrial genome. First, we used the following overlapping primers to amplify the mtDNA in two halves: Set 1 (10 Kb amplicon) with forward (3301, GCC AGC CTG ACC CAT AGC CAT AAT AT) and reverse (13367, GAG AGA TTT TAT GGG TGT AAT GCG G); Set 2 (7.5 Kb amplicon) with forward (12791, TCC CAC TCC TAA ACA CAT CC) and reverse (3880, TTT ATG GGG TGA TGT GAG CC). For primer set 1, we used the following PCR conditions: 94 °C for 2 min; 10 cycles: 94 °C for 10 s, 57 °C for 30 s, 68 °C for 10 min; 25 cycles: 94 °C for 10 s, 57 °C for 30 s, 68 °C for 12 min; 72 °C for 5 min (Gene Amp PCR system 9700, Applied Biosystems, Foster City, CA, USA). For primer set 2, we used the following PCR conditions: 94 °C for 2 min; 10 cycles: 94 °C for 10 s, 51 °C for 30 s, 68 °C for 7.5 min; 25 cycles: 94 °C for 10 s, 51 °C for 30 s, 68 °C for 9 min; 72 °C for 5 min. Lastly, we cleaned the PCR products with the Zymo DNA Clean and Concentrator kit (Zymo, Irvine, CA, USA) and pooled the mtDNA for library preparation.

We employed a long-range PCR (SequalPrep Long PCR Kit, Life Technologies, Grand Island, NY, USA) based method to amplify the complete mitochondrial genome. We used the following overlapping primers to amplify the mtDNA in two halves: Set 1 (10 kb amplicon) with forward (3301, GCC AGC CTG ACC CAT AGC CAT AAT AT), and reverse (13367, GAG AGA TTT TAT GGG TGT AAT GCG G); Set 2 (7.5 kb amplicon) with forward (12791, TCC CAC TCC TAA ACA CAT CC), and reverse (3880, TTT ATG GGG TGA TGT GAG CC). For primer set 1, we used the following PCR conditions: 94 °C for 2 min; 10 cycles: 94 °C for 10 s, 57 °C for 30 s, 68 °C for 10 min; 25 cycles: 94 °C for 10 s, 57 °C for 30 s, 68 °C for 12 min; 72 °C for 5 min (Gene Amp PCR system 9700, Applied Biosystems, Foster City, CA, USA). Then, for set 2, we used the following PCR conditions: 94 °C for 2 min; 10 cycles: 94 °C for 10 s, 51 °C for 30 s, 68 °C for 7.5 min; 25 cycles: 94 °C for 10 s, 51 °C for 30 s, 68 °C for 9 min; 72 °C for 5 min. Lastly, we cleaned the PCR products with the Zymo DNA Clean and Concentrator kit (Zymo, Irvine, CA, USA), then pooled the mtDNA for library preparation.

Genomic DNA purification was done using 10 μl of the hygromycin-resistant cells. The extracted DNA was used for the amplification of the unique molecular barcodes of the yeast strains by PCR using primers U1+KanB and D1+KanC for the uptags and downtags (Giaever et al. 2002 (link)), which amplify products of 299 and 624 bp, respectively. Both tags were amplified in a single 20 μl PCR reaction using the SequalPrep Long PCR Kit (Invitrogen). The PCR products were then purified and used for library preparation and multiplex sequencing (Smith et al. 2009 (link)) using the NEBNext DNA Sample Preparation kit (New England BioLabs). The sequencing was done on Illumina HiSequation 2000 or MiSeq instruments with paired ends of 101 or 150 bp, respectively.

Primers were constructed with our in-house primer design pipeline, based on primer3 software (http://biotools.umassmed.edu/bioapps/primer3_www.cgi), and purchased from Sigma. PCR experiments were performed as follows: 10 ng of genomic DNA was used with the SequalPrep Long PCR Kit (Invitrogen) in 20 μl volumes applying the following PCR conditions in a MJ Mini thermocycler (BioRad): 94°C for 3 min, followed by 10 cycles of 94°C for 10 s, 62°C for 30 s and 68°C for 6 min and 25 cycles of 94°C for 10 s, 60°C for 30 s, and 68°C for 7 min, followed by a final cycle of 72°C for 10 min. PCR products were analyzed on a 1% agarose gel stained with SYBR Safe Dye (Invitrogen).

A platform was developed to analyze the plasticity of norovirus genotypes at the full genome level. Briefly, viral RNA was extracted from 10% (w/v) stool suspensions using the MagMax Viral RNA Isolation Kit (Ambion, California, USA) following manufacturer’s recommendations. Complementary DNA was synthesized from the viral RNA using the Tx30SXN primer (GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT [77 (link)]) at 5μM final concentration, and the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, California, USA) following manufacturer’s recommendations except that only 0.1 μL of Enzyme Mix was used per reaction. Amplification of the full-length genome was performed using 5 μl of the RT reaction, a set of primers that target the conserved regions of the 5’- and 3’-end of GII noroviruses (GII1-35: GTGAATGAAGATGGCGTCTAACGACGCTTCCGCTG, and Tx30SXN), and the SequalPrep Long PCR Kit (Invitrogen, California, USA) following manufacturer’s recommendations. Amplicons were excised from an agarose gel and purified with the QIAquick Gel Extraction Kit (Qiagen, California, USA).

A long-range PCR to was performed using the primer pair GGCAAACTTGGGAGTGGTAA (Chr3:31,659,781–31,659,762) and CCCCCTCAAATAAACCATGA (Chr3:32,346,375–32,346,356) and the SequalPrep^™ Long PCR kit (Invitrogen). The PCR fragments were analyzed using FragmentAnalyzer^™ (Advanced Analytical).