Trizol

RNA was extracted from cells and tissues using TRIzol (Gene Copoeia, MD, USA), and 1 µg total RNA from each sample was reverse transcribed to cDNA using specific primers and SYBR Green reaction mix (Takara Biotech). Real-time qPCR was performed on the Bio-Rad Real-Time PCR cycler. Relative gene expression levels were calculated by the 2^-ΔΔct method. The primer sequences were as follows: SCAMP5 forward: GCCCCATCAAGGTTCAGGAC, reverse: TACGTGTAATTGGGGGTGGC; GAPDH forward: TGGTATCGTGGAAGGACTC, reverse: AGTAGAGGCAGGGATGATG.

The mRNA expression levels of prognostic genes were detected in 10 pairs of ccRCC tissue samples and para-cancerous control tissue samples from the First Hospital of ShanXi Medical University. This study was allowed by the Ethics Committee of the First Hospital of ShanXi Medical University. All patients had approved for the use of clinical tissues for research purposes. Total RNA was isolated using TRIzol (Genecopoeia). The SureScript-First-strand-cDNA-synthesis-kit (Genecopoeia) was used for first-strand cDNA synthesis. For the analysis of the target gene mRNA levels, qPCR was performed using BlazeTaq™ SYBR ^® Green qPCR Mix 2.0 according to the manufacturer’s instructions (Genecopoeia). The relative expression of mRNA was calculated by the 2^−ΔΔCt method with the normalization to GAPDH. All specific primers were shown in Table 1.

RNA was extracted from cells using TRIzol (Gene Copoeia, MD, USA), and 1 µg total RNA from each sample was reverse transcribed to cDNA using PrimeScript^® RT Master Mix (Takara, Cat. NO. RR036A). SYBR^® Green (Applied Biosystems™, Cat. NO. 4309155) was used for qRT-PCR analysis. The ΔCt method was used to analyze mRNA levels relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences were listed in Table S3.